Incidental Mutation 'R6699:Car15'
ID528699
Institutional Source Beutler Lab
Gene Symbol Car15
Ensembl Gene ENSMUSG00000090236
Gene Namecarbonic anhydrase 15
SynonymsCals2
MMRRC Submission
Accession Numbers

Genbank: NM_030558; MGI: 1931324  

Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6699 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location17835276-17838364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17836574 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Ref Sequence ENSEMBL: ENSMUSP00000113400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012152] [ENSMUST00000066127] [ENSMUST00000117082] [ENSMUST00000117945] [ENSMUST00000118960] [ENSMUST00000150068]
Predicted Effect probably null
Transcript: ENSMUST00000012152
SMART Domains Protein: ENSMUSP00000012152
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066127
SMART Domains Protein: ENSMUSP00000064603
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
transmembrane domain 274 296 N/A INTRINSIC
low complexity region 298 306 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117082
SMART Domains Protein: ENSMUSP00000113506
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 5.86e-11 SMART
CLECT 113 264 1.06e-14 SMART
VWC 269 330 1.42e-9 SMART
transmembrane domain 344 366 N/A INTRINSIC
low complexity region 368 376 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117945
SMART Domains Protein: ENSMUSP00000112783
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
VWC 267 328 1.42e-9 SMART
transmembrane domain 342 364 N/A INTRINSIC
low complexity region 366 374 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118960
AA Change: D166G

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113400
Gene: ENSMUSG00000090236
AA Change: D166G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 25 293 2.31e-106 SMART
low complexity region 307 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135229
Predicted Effect probably benign
Transcript: ENSMUST00000150068
SMART Domains Protein: ENSMUSP00000115071
Gene: ENSMUSG00000092470

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 559 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232529
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,144,368 T894A probably damaging Het
Adam39 A G 8: 40,826,657 K695R probably benign Het
Agfg1 G A 1: 82,858,454 probably null Het
Ankrd44 G A 1: 54,762,445 T241I probably damaging Het
Cpne2 G A 8: 94,563,959 V391M probably damaging Het
Ddx27 C T 2: 167,020,503 T155I possibly damaging Het
F830045P16Rik T C 2: 129,460,421 D417G probably damaging Het
Fam217b T G 2: 178,420,417 M58R probably benign Het
Ftmt T C 18: 52,331,665 S18P possibly damaging Het
Gm16494 C T 17: 47,016,908 V17M probably damaging Het
Gm36864 A T 7: 44,238,772 I342F possibly damaging Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Hist1h4k A T 13: 21,750,504 M1K probably null Het
Hmgcr T C 13: 96,660,209 E191G probably damaging Het
Hrc A G 7: 45,335,695 D90G possibly damaging Het
Kbtbd7 A G 14: 79,428,192 E488G probably benign Het
Krtap26-1 T C 16: 88,647,715 N6S unknown Het
Mgat2 A G 12: 69,184,781 D43G probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Olfr1124 A T 2: 87,434,816 I110F probably benign Het
Olfr224 T A 11: 58,567,205 I47L possibly damaging Het
Pcdhb11 T A 18: 37,422,937 V440E probably damaging Het
Pcdhb18 T A 18: 37,491,952 H778Q probably benign Het
Plekha7 T C 7: 116,135,175 E1025G probably damaging Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Rph3al A T 11: 75,900,837 probably benign Het
Rrm1 T A 7: 102,460,825 Y556N probably damaging Het
Saal1 A T 7: 46,692,817 C401S probably damaging Het
Sec14l3 T C 11: 4,075,193 S268P possibly damaging Het
Tmem54 A G 4: 129,111,325 I199M probably benign Het
Tomm70a A G 16: 57,142,802 M395V probably benign Het
Topors A G 4: 40,262,300 V328A probably damaging Het
Vmn2r61 T G 7: 42,300,156 S667A probably benign Het
Vmn2r68 G A 7: 85,232,375 A499V possibly damaging Het
Zcchc14 A T 8: 121,608,616 probably benign Het
Other mutations in Car15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Car15 APN 16 17836634 missense probably damaging 1.00
IGL01292:Car15 APN 16 17835529 missense probably damaging 1.00
IGL01361:Car15 APN 16 17837854 missense probably damaging 1.00
IGL03061:Car15 APN 16 17835385 missense possibly damaging 0.59
R0383:Car15 UTSW 16 17836753 nonsense probably null
R0544:Car15 UTSW 16 17835816 splice site probably benign
R1771:Car15 UTSW 16 17836866 missense probably damaging 0.97
R1951:Car15 UTSW 16 17837405 missense possibly damaging 0.47
R2318:Car15 UTSW 16 17836599 missense probably benign 0.02
R2910:Car15 UTSW 16 17838142 unclassified probably benign
R4370:Car15 UTSW 16 17835435 missense probably damaging 0.99
R4843:Car15 UTSW 16 17836608 missense possibly damaging 0.60
R5110:Car15 UTSW 16 17835347 missense possibly damaging 0.53
R6251:Car15 UTSW 16 17837363 missense probably benign 0.09
R6360:Car15 UTSW 16 17838066 missense probably benign 0.01
R7127:Car15 UTSW 16 17838196 unclassified probably benign
R7567:Car15 UTSW 16 17836788 missense probably damaging 1.00
R8289:Car15 UTSW 16 17836716 critical splice donor site probably null
X0026:Car15 UTSW 16 17835532 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTTCATTCACGAGGATTTGGACTC -3'
(R):5'- CTGGATGAGAAGCATGGCTC -3'

Sequencing Primer
(F):5'- CATTCACGAGGATTTGGACTCATCTG -3'
(R):5'- TGAGAAGCATGGCTCTATGG -3'
Posted On2018-07-24