Incidental Mutation 'R6699:Krtap26-1'
ID528701
Institutional Source Beutler Lab
Gene Symbol Krtap26-1
Ensembl Gene ENSMUSG00000071471
Gene Namekeratin associated protein 26-1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6699 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location88646824-88647796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88647715 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 6 (N6S)
Ref Sequence ENSEMBL: ENSMUSP00000093626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095934]
Predicted Effect unknown
Transcript: ENSMUST00000095934
AA Change: N6S
SMART Domains Protein: ENSMUSP00000093626
Gene: ENSMUSG00000071471
AA Change: N6S

DomainStartEndE-ValueType
Pfam:PMG 4 213 2.9e-65 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,144,368 T894A probably damaging Het
Adam39 A G 8: 40,826,657 K695R probably benign Het
Agfg1 G A 1: 82,858,454 probably null Het
Ankrd44 G A 1: 54,762,445 T241I probably damaging Het
Car15 T C 16: 17,836,574 D166G probably null Het
Cpne2 G A 8: 94,563,959 V391M probably damaging Het
Ddx27 C T 2: 167,020,503 T155I possibly damaging Het
F830045P16Rik T C 2: 129,460,421 D417G probably damaging Het
Fam217b T G 2: 178,420,417 M58R probably benign Het
Ftmt T C 18: 52,331,665 S18P possibly damaging Het
Gm16494 C T 17: 47,016,908 V17M probably damaging Het
Gm36864 A T 7: 44,238,772 I342F possibly damaging Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Hist1h4k A T 13: 21,750,504 M1K probably null Het
Hmgcr T C 13: 96,660,209 E191G probably damaging Het
Hrc A G 7: 45,335,695 D90G possibly damaging Het
Kbtbd7 A G 14: 79,428,192 E488G probably benign Het
Mgat2 A G 12: 69,184,781 D43G probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Olfr1124 A T 2: 87,434,816 I110F probably benign Het
Olfr224 T A 11: 58,567,205 I47L possibly damaging Het
Pcdhb11 T A 18: 37,422,937 V440E probably damaging Het
Pcdhb18 T A 18: 37,491,952 H778Q probably benign Het
Plekha7 T C 7: 116,135,175 E1025G probably damaging Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Rph3al A T 11: 75,900,837 probably benign Het
Rrm1 T A 7: 102,460,825 Y556N probably damaging Het
Saal1 A T 7: 46,692,817 C401S probably damaging Het
Sec14l3 T C 11: 4,075,193 S268P possibly damaging Het
Tmem54 A G 4: 129,111,325 I199M probably benign Het
Tomm70a A G 16: 57,142,802 M395V probably benign Het
Topors A G 4: 40,262,300 V328A probably damaging Het
Vmn2r61 T G 7: 42,300,156 S667A probably benign Het
Vmn2r68 G A 7: 85,232,375 A499V possibly damaging Het
Zcchc14 A T 8: 121,608,616 probably benign Het
Other mutations in Krtap26-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Krtap26-1 APN 16 88647379 missense possibly damaging 0.62
IGL01721:Krtap26-1 APN 16 88647172 missense probably damaging 1.00
IGL01963:Krtap26-1 APN 16 88647668 missense probably damaging 1.00
IGL02524:Krtap26-1 APN 16 88647479 missense possibly damaging 0.70
R0383:Krtap26-1 UTSW 16 88647243 nonsense probably null
R2367:Krtap26-1 UTSW 16 88647325 missense probably benign 0.28
R4694:Krtap26-1 UTSW 16 88647220 missense possibly damaging 0.70
R6884:Krtap26-1 UTSW 16 88647579 missense probably damaging 1.00
R7299:Krtap26-1 UTSW 16 88647244 missense possibly damaging 0.49
R7808:Krtap26-1 UTSW 16 88647310 missense not run
Predicted Primers PCR Primer
(F):5'- GGTTCTGCAAAGGTCTCTGG -3'
(R):5'- CATCCGGTTTTATGGGAGGC -3'

Sequencing Primer
(F):5'- TGGGCAGTTGTCCATGAACC -3'
(R):5'- TATGAGAGAGTTTAGATGCAGCCTC -3'
Posted On2018-07-24