Incidental Mutation 'R6701:Slc35f5'
ID528709
Institutional Source Beutler Lab
Gene Symbol Slc35f5
Ensembl Gene ENSMUSG00000026342
Gene Namesolute carrier family 35, member F5
Synonyms1300003P13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R6701 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location125560595-125595820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125562610 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000139639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027580] [ENSMUST00000190037]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027580
AA Change: V81A

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027580
Gene: ENSMUSG00000026342
AA Change: V81A

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
transmembrane domain 69 86 N/A INTRINSIC
transmembrane domain 101 120 N/A INTRINSIC
Pfam:EamA 226 317 2.1e-8 PFAM
transmembrane domain 329 348 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 397 419 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190037
AA Change: V103A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139639
Gene: ENSMUSG00000026342
AA Change: V103A

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
transmembrane domain 91 108 N/A INTRINSIC
transmembrane domain 123 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Arid4a A T 12: 71,087,512 K1196I probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Bfsp2 C T 9: 103,479,878 V117M possibly damaging Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Ddx21 T C 10: 62,590,691 Y461C probably damaging Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eml6 T A 11: 29,785,748 L1139F probably damaging Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Guf1 T A 5: 69,558,253 D47E probably damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Hsd17b1 C A 11: 101,080,155 C312* probably null Het
Ighg2b T C 12: 113,307,079 T144A unknown Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1009 A G 2: 85,722,331 K309E probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r67 G A 7: 85,152,815 P93S probably damaging Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Zfp990 A G 4: 145,538,178 D582G probably benign Het
Other mutations in Slc35f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Slc35f5 APN 1 125587424 missense probably damaging 1.00
IGL01844:Slc35f5 APN 1 125589875 missense probably damaging 0.96
IGL02218:Slc35f5 APN 1 125584555 missense probably damaging 1.00
IGL02586:Slc35f5 APN 1 125584536 missense probably damaging 1.00
IGL03000:Slc35f5 APN 1 125574742 missense probably damaging 1.00
IGL03160:Slc35f5 APN 1 125574735 missense probably damaging 1.00
IGL03181:Slc35f5 APN 1 125585185 missense probably damaging 1.00
IGL02984:Slc35f5 UTSW 1 125562513 missense probably benign 0.28
R0127:Slc35f5 UTSW 1 125576205 missense probably damaging 1.00
R0390:Slc35f5 UTSW 1 125585095 missense probably damaging 1.00
R0513:Slc35f5 UTSW 1 125576169 splice site probably benign
R1701:Slc35f5 UTSW 1 125570593 missense possibly damaging 0.77
R1716:Slc35f5 UTSW 1 125584532 missense possibly damaging 0.65
R2211:Slc35f5 UTSW 1 125579264 missense possibly damaging 0.74
R3024:Slc35f5 UTSW 1 125568598 missense probably benign 0.00
R3870:Slc35f5 UTSW 1 125562361 missense probably benign 0.00
R4239:Slc35f5 UTSW 1 125572474 missense possibly damaging 0.94
R4547:Slc35f5 UTSW 1 125572382 missense probably benign 0.00
R5622:Slc35f5 UTSW 1 125589956 missense probably damaging 1.00
R5688:Slc35f5 UTSW 1 125591038 missense probably benign 0.23
R5876:Slc35f5 UTSW 1 125587363 critical splice acceptor site probably null
R7292:Slc35f5 UTSW 1 125572485 missense probably damaging 0.99
R7368:Slc35f5 UTSW 1 125584519 missense probably damaging 1.00
R7530:Slc35f5 UTSW 1 125584538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGAAGCCCTTGCAACA -3'
(R):5'- ACAACAAAGAGCATCCTGTCAATTT -3'

Sequencing Primer
(F):5'- CAGAGACTACTAGCAAATGTCTCTTG -3'
(R):5'- CATCATTAGCAAAATCCTCTAGG -3'
Posted On2018-07-24