Incidental Mutation 'R6701:Olfr1009'
ID528720
Institutional Source Beutler Lab
Gene Symbol Olfr1009
Ensembl Gene ENSMUSG00000043226
Gene Nameolfactory receptor 1009
SynonymsMOR175-3, GA_x6K02T2Q125-47195323-47196267
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6701 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85715419-85725136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85722331 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 309 (K309E)
Ref Sequence ENSEMBL: ENSMUSP00000150450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055517] [ENSMUST00000216443]
Predicted Effect probably benign
Transcript: ENSMUST00000055517
AA Change: K309E

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061475
Gene: ENSMUSG00000043226
AA Change: K309E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-55 PFAM
Pfam:7tm_1 41 290 4.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213600
Predicted Effect probably benign
Transcript: ENSMUST00000216443
AA Change: K309E

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Arid4a A T 12: 71,087,512 K1196I probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Bfsp2 C T 9: 103,479,878 V117M possibly damaging Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Ddx21 T C 10: 62,590,691 Y461C probably damaging Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eml6 T A 11: 29,785,748 L1139F probably damaging Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Guf1 T A 5: 69,558,253 D47E probably damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Hsd17b1 C A 11: 101,080,155 C312* probably null Het
Ighg2b T C 12: 113,307,079 T144A unknown Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc35f5 T C 1: 125,562,610 V103A probably damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r67 G A 7: 85,152,815 P93S probably damaging Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Zfp990 A G 4: 145,538,178 D582G probably benign Het
Other mutations in Olfr1009
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Olfr1009 APN 2 85722239 missense probably damaging 1.00
IGL01862:Olfr1009 APN 2 85722128 missense probably damaging 0.99
IGL02868:Olfr1009 APN 2 85721575 missense probably benign 0.19
IGL02904:Olfr1009 APN 2 85721755 missense probably damaging 0.99
IGL03240:Olfr1009 APN 2 85722331 nonsense probably null
IGL03347:Olfr1009 APN 2 85721807 missense probably benign 0.01
R1148:Olfr1009 UTSW 2 85722276 nonsense probably null
R1148:Olfr1009 UTSW 2 85722276 nonsense probably null
R1446:Olfr1009 UTSW 2 85721573 missense probably damaging 0.99
R3782:Olfr1009 UTSW 2 85721696 missense probably damaging 1.00
R4343:Olfr1009 UTSW 2 85722248 missense probably damaging 1.00
R4836:Olfr1009 UTSW 2 85721449 missense probably benign
R4845:Olfr1009 UTSW 2 85721492 nonsense probably null
R5490:Olfr1009 UTSW 2 85722322 missense probably benign 0.01
R5534:Olfr1009 UTSW 2 85721987 missense probably benign 0.35
R5679:Olfr1009 UTSW 2 85722046 missense probably damaging 1.00
R6476:Olfr1009 UTSW 2 85721584 missense probably damaging 1.00
R7024:Olfr1009 UTSW 2 85721608 missense probably damaging 1.00
R7140:Olfr1009 UTSW 2 85721474 missense probably damaging 0.97
R7174:Olfr1009 UTSW 2 85721953 missense possibly damaging 0.81
X0020:Olfr1009 UTSW 2 85721978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTCCCATGTTACAGCAG -3'
(R):5'- AGCTAAGCAAAACACTCTGCTTG -3'

Sequencing Primer
(F):5'- ACAGCAGTTTCTATTTTGTACGGGAC -3'
(R):5'- GCAAAACACTCTGCTTGTTATTTTC -3'
Posted On2018-07-24