Mutagenetix > Incidental Mutation

Incidental Mutation 'R6701:Col24a1'

528726

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6701 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 145314380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 171 (T171A)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]

AlphaFold

Q30D77

Predicted Effect

probably benign
Transcript: ENSMUST00000029848
AA Change: T171A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: T171A

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139001

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap12	A	T	10: 4,355,243	K684N	probably damaging	Het
Akna	C	T	4: 63,395,280	G202D	probably benign	Het
Alpk1	T	A	3: 127,729,336	D19V	probably damaging	Het
Arid4a	A	T	12: 71,087,512	K1196I	probably damaging	Het
Asic3	A	T	5: 24,414,129	M140L	possibly damaging	Het
BC055324	T	C	1: 163,971,843		probably null	Het
Bfsp2	C	T	9: 103,479,878	V117M	possibly damaging	Het
Cd244	C	A	1: 171,574,155	L150M	possibly damaging	Het
Cd3e	T	C	9: 45,001,053	Y131C	probably damaging	Het
Clptm1l	T	C	13: 73,608,906	I202T	probably benign	Het
Cnot4	G	T	6: 35,068,604	T224K	probably damaging	Het
Col6a3	C	T	1: 90,792,462	R1552Q	probably benign	Het
Dcc	T	A	18: 71,809,120	T309S	probably benign	Het
Ddx21	T	C	10: 62,590,691	Y461C	probably damaging	Het
Dnah10	G	A	5: 124,760,159	V989M	probably benign	Het
Dppa4	A	T	16: 48,291,311	K220*	probably null	Het
Dysf	G	A	6: 84,112,190	G912S	probably damaging	Het
Efhb	A	T	17: 53,399,063	N815K	probably benign	Het
Eml6	T	A	11: 29,785,748	L1139F	probably damaging	Het
Eprs	T	G	1: 185,370,890	I78S	probably damaging	Het
Fat1	C	A	8: 44,950,681	S156R	probably damaging	Het
Frzb	G	A	2: 80,446,819	R8W	possibly damaging	Het
Guf1	T	A	5: 69,558,253	D47E	probably damaging	Het
Haus3	A	T	5: 34,167,734	F194I	probably damaging	Het
Hivep3	C	T	4: 120,094,540	R18W	probably damaging	Het
Hnf1b	A	G	11: 83,889,094	T392A	probably damaging	Het
Hsd17b1	C	A	11: 101,080,155	C312*	probably null	Het
Ighg2b	T	C	12: 113,307,079	T144A	unknown	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Jhy	T	C	9: 40,917,591	R340G	probably damaging	Het
Klra3	C	G	6: 130,330,253	V144L	probably benign	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Lrmp	G	T	6: 145,144,976	E61*	probably null	Het
Lrrc4	A	G	6: 28,830,906	F237L	possibly damaging	Het
Lyst	T	A	13: 13,681,485	C2464S	probably benign	Het
Maml1	T	C	11: 50,266,682	E222G	probably damaging	Het
Med15	C	T	16: 17,671,583		probably benign	Het
Naalad2	T	C	9: 18,385,148	I69V	probably null	Het
Neb	T	C	2: 52,291,208	K1129R	probably damaging	Het
Nsun6	A	T	2: 15,036,302	N159K	probably benign	Het
Nup153	A	T	13: 46,687,065	N1022K	probably benign	Het
Olfr1009	A	G	2: 85,722,331	K309E	probably benign	Het
Olfr1138	C	T	2: 87,737,409	R305K	probably benign	Het
Olfr389	T	C	11: 73,776,470	N286D	probably damaging	Het
Otof	T	A	5: 30,370,797	K1901*	probably null	Het
Pde1c	A	T	6: 56,181,700	Y136N	probably damaging	Het
Phc1	G	T	6: 122,325,774	N263K	probably damaging	Het
Plxna1	A	T	6: 89,319,448	D1871E	probably damaging	Het
Prdm6	T	A	18: 53,536,679	M123K	possibly damaging	Het
Ranbp17	T	C	11: 33,475,066	D430G	probably damaging	Het
Rsl24d1	C	A	9: 73,114,997	T287K	probably damaging	Het
Scn1a	G	A	2: 66,337,960	R101W	probably damaging	Het
Scn8a	A	G	15: 101,040,096	D1741G	probably damaging	Het
Serpinb1c	T	C	13: 32,896,941	Q53R	probably benign	Het
Serpinf2	C	T	11: 75,432,443	R479H	probably damaging	Het
Sis	T	A	3: 72,949,527	D448V	probably damaging	Het
Slc27a6	T	A	18: 58,579,875	D256E	probably benign	Het
Slc30a8	A	G	15: 52,331,574	Y243C	possibly damaging	Het
Slc35f5	T	C	1: 125,562,610	V103A	probably damaging	Het
Slc44a2	T	C	9: 21,320,853		probably null	Het
Slc7a9	T	C	7: 35,459,849	L327P	probably damaging	Het
Stat4	A	G	1: 52,102,974	Y660C	probably damaging	Het
Terb1	T	C	8: 104,472,756	T519A	possibly damaging	Het
Tonsl	A	T	15: 76,629,300	S1245T	probably damaging	Het
Ttn	A	T	2: 76,788,818	S16072R	probably damaging	Het
Ttn	A	T	2: 76,909,246	Y3650N	probably benign	Het
Uhrf1bp1	T	A	17: 27,887,357	C952*	probably null	Het
Uso1	T	C	5: 92,166,585	F117S	probably damaging	Het
Vmn1r211	T	C	13: 22,851,609	H296R	probably benign	Het
Vmn2r67	G	A	7: 85,152,815	P93S	probably damaging	Het
Xirp2	A	T	2: 67,516,225	I2937F	possibly damaging	Het
Zc2hc1c	C	A	12: 85,289,672		probably null	Het
Zfp12	T	C	5: 143,244,464	V182A	probably benign	Het
Zfp473	G	T	7: 44,732,794	A705D	possibly damaging	Het
Zfp937	G	T	2: 150,239,216	G389C	probably damaging	Het
Zfp990	A	G	4: 145,538,178	D582G	probably benign	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTGACAGTATTGATTGGGTTGC -3'
(R):5'- CAGGTGTCTGCAATACTCCG -3'

Sequencing Primer
(F):5'- GGGTTGCAATCATTCAAAGTGAAC -3'
(R):5'- GCTGTGGAAGGCATGATCTCC -3'

Posted On

2018-07-24