Incidental Mutation 'R6701:Zfp990'
ID 528729
Institutional Source Beutler Lab
Gene Symbol Zfp990
Ensembl Gene ENSMUSG00000078503
Gene Name zinc finger protein 990
Synonyms Gm13225
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R6701 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 145510759-145539188 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 145538178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 582 (D582G)
Ref Sequence ENSEMBL: ENSMUSP00000101368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105741] [ENSMUST00000105742] [ENSMUST00000136309]
AlphaFold B1AVN5
Predicted Effect probably benign
Transcript: ENSMUST00000105741
AA Change: D582G

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101367
Gene: ENSMUSG00000078503
AA Change: D582G

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105742
AA Change: D582G

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101368
Gene: ENSMUSG00000078503
AA Change: D582G

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136309
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Arid4a A T 12: 71,087,512 K1196I probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Bfsp2 C T 9: 103,479,878 V117M possibly damaging Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Ddx21 T C 10: 62,590,691 Y461C probably damaging Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eml6 T A 11: 29,785,748 L1139F probably damaging Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Guf1 T A 5: 69,558,253 D47E probably damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Hsd17b1 C A 11: 101,080,155 C312* probably null Het
Ighg2b T C 12: 113,307,079 T144A unknown Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1009 A G 2: 85,722,331 K309E probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc35f5 T C 1: 125,562,610 V103A probably damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r67 G A 7: 85,152,815 P93S probably damaging Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Other mutations in Zfp990
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Zfp990 APN 4 145537868 missense probably damaging 0.99
IGL01774:Zfp990 APN 4 145536948 missense probably benign 0.28
IGL01895:Zfp990 APN 4 145536857 missense probably damaging 0.97
IGL01895:Zfp990 APN 4 145536858 missense probably damaging 0.99
IGL02349:Zfp990 APN 4 145530877 utr 5 prime probably benign
IGL02598:Zfp990 APN 4 145536963 missense possibly damaging 0.67
IGL02940:Zfp990 APN 4 145534922 splice site probably null
IGL03026:Zfp990 APN 4 145537110 missense possibly damaging 0.54
R0007:Zfp990 UTSW 4 145537438 missense probably benign 0.00
R0352:Zfp990 UTSW 4 145536604 missense probably damaging 0.99
R0631:Zfp990 UTSW 4 145537302 missense possibly damaging 0.89
R1490:Zfp990 UTSW 4 145537283 missense probably benign 0.44
R1537:Zfp990 UTSW 4 145536996 missense possibly damaging 0.67
R1832:Zfp990 UTSW 4 145538210 missense possibly damaging 0.51
R1956:Zfp990 UTSW 4 145534882 missense probably damaging 1.00
R1982:Zfp990 UTSW 4 145536869 missense probably damaging 0.99
R2024:Zfp990 UTSW 4 145537404 missense possibly damaging 0.69
R2097:Zfp990 UTSW 4 145537322 missense possibly damaging 0.94
R2235:Zfp990 UTSW 4 145537891 missense probably damaging 0.99
R4194:Zfp990 UTSW 4 145536977 splice site probably null
R4195:Zfp990 UTSW 4 145536977 splice site probably null
R4418:Zfp990 UTSW 4 145536728 missense possibly damaging 0.87
R4617:Zfp990 UTSW 4 145537046 missense possibly damaging 0.59
R4736:Zfp990 UTSW 4 145536942 missense possibly damaging 0.95
R4880:Zfp990 UTSW 4 145537920 missense probably benign
R4941:Zfp990 UTSW 4 145536837 missense probably damaging 1.00
R5014:Zfp990 UTSW 4 145538099 missense possibly damaging 0.93
R5945:Zfp990 UTSW 4 145538043 missense probably damaging 0.98
R6238:Zfp990 UTSW 4 145537913 missense probably damaging 1.00
R6255:Zfp990 UTSW 4 145537789 missense probably benign 0.00
R6267:Zfp990 UTSW 4 145538103 missense possibly damaging 0.59
R6296:Zfp990 UTSW 4 145538103 missense possibly damaging 0.59
R6412:Zfp990 UTSW 4 145537568 missense probably benign 0.00
R6616:Zfp990 UTSW 4 145537145 missense probably benign 0.01
R6720:Zfp990 UTSW 4 145536927 missense possibly damaging 0.67
R7015:Zfp990 UTSW 4 145536635 missense probably damaging 0.99
R7487:Zfp990 UTSW 4 145537587 missense probably damaging 1.00
R7722:Zfp990 UTSW 4 145536962 missense possibly damaging 0.86
R8749:Zfp990 UTSW 4 145537586 missense probably damaging 0.96
R8785:Zfp990 UTSW 4 145537676 missense probably benign 0.00
R9161:Zfp990 UTSW 4 145534939 missense possibly damaging 0.71
R9211:Zfp990 UTSW 4 145537601 missense probably damaging 0.98
Z1176:Zfp990 UTSW 4 145536811 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGCAGTGAATGTGACAAATGC -3'
(R):5'- TAGGCCAAAAGTAAAGGATTCATACCC -3'

Sequencing Primer
(F):5'- GCAGTGAATGTGACAAATGCTTTAC -3'
(R):5'- CTTGGAAAAGGATTGTCTCATTCAC -3'
Posted On 2018-07-24