Incidental Mutation 'R6701:Zfp990'
ID528729
Institutional Source Beutler Lab
Gene Symbol Zfp990
Ensembl Gene ENSMUSG00000078503
Gene Namezinc finger protein 990
SynonymsGm13225
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6701 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location145510759-145539188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145538178 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 582 (D582G)
Ref Sequence ENSEMBL: ENSMUSP00000101368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105741] [ENSMUST00000105742] [ENSMUST00000136309]
Predicted Effect probably benign
Transcript: ENSMUST00000105741
AA Change: D582G

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101367
Gene: ENSMUSG00000078503
AA Change: D582G

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105742
AA Change: D582G

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101368
Gene: ENSMUSG00000078503
AA Change: D582G

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136309
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Arid4a A T 12: 71,087,512 K1196I probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Bfsp2 C T 9: 103,479,878 V117M possibly damaging Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Ddx21 T C 10: 62,590,691 Y461C probably damaging Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eml6 T A 11: 29,785,748 L1139F probably damaging Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Guf1 T A 5: 69,558,253 D47E probably damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Hsd17b1 C A 11: 101,080,155 C312* probably null Het
Ighg2b T C 12: 113,307,079 T144A unknown Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1009 A G 2: 85,722,331 K309E probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc35f5 T C 1: 125,562,610 V103A probably damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r67 G A 7: 85,152,815 P93S probably damaging Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Other mutations in Zfp990
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Zfp990 APN 4 145537868 missense probably damaging 0.99
IGL01774:Zfp990 APN 4 145536948 missense probably benign 0.28
IGL01895:Zfp990 APN 4 145536857 missense probably damaging 0.97
IGL01895:Zfp990 APN 4 145536858 missense probably damaging 0.99
IGL02349:Zfp990 APN 4 145530877 utr 5 prime probably benign
IGL02598:Zfp990 APN 4 145536963 missense possibly damaging 0.67
IGL02940:Zfp990 APN 4 145534922 splice site probably null
IGL03026:Zfp990 APN 4 145537110 missense possibly damaging 0.54
R0007:Zfp990 UTSW 4 145537438 missense probably benign 0.00
R0352:Zfp990 UTSW 4 145536604 missense probably damaging 0.99
R0631:Zfp990 UTSW 4 145537302 missense possibly damaging 0.89
R1490:Zfp990 UTSW 4 145537283 missense probably benign 0.44
R1537:Zfp990 UTSW 4 145536996 missense possibly damaging 0.67
R1832:Zfp990 UTSW 4 145538210 missense possibly damaging 0.51
R1956:Zfp990 UTSW 4 145534882 missense probably damaging 1.00
R1982:Zfp990 UTSW 4 145536869 missense probably damaging 0.99
R2024:Zfp990 UTSW 4 145537404 missense possibly damaging 0.69
R2097:Zfp990 UTSW 4 145537322 missense possibly damaging 0.94
R2235:Zfp990 UTSW 4 145537891 missense probably damaging 0.99
R4194:Zfp990 UTSW 4 145536977 splice site probably null
R4195:Zfp990 UTSW 4 145536977 splice site probably null
R4418:Zfp990 UTSW 4 145536728 missense possibly damaging 0.87
R4617:Zfp990 UTSW 4 145537046 missense possibly damaging 0.59
R4736:Zfp990 UTSW 4 145536942 missense possibly damaging 0.95
R4880:Zfp990 UTSW 4 145537920 missense probably benign
R4941:Zfp990 UTSW 4 145536837 missense probably damaging 1.00
R5014:Zfp990 UTSW 4 145538099 missense possibly damaging 0.93
R5945:Zfp990 UTSW 4 145538043 missense probably damaging 0.98
R6238:Zfp990 UTSW 4 145537913 missense probably damaging 1.00
R6255:Zfp990 UTSW 4 145537789 missense probably benign 0.00
R6267:Zfp990 UTSW 4 145538103 missense possibly damaging 0.59
R6296:Zfp990 UTSW 4 145538103 missense possibly damaging 0.59
R6412:Zfp990 UTSW 4 145537568 missense probably benign 0.00
R6616:Zfp990 UTSW 4 145537145 missense probably benign 0.01
R6720:Zfp990 UTSW 4 145536927 missense possibly damaging 0.67
R7015:Zfp990 UTSW 4 145536635 missense probably damaging 0.99
R7487:Zfp990 UTSW 4 145537587 missense probably damaging 1.00
R7722:Zfp990 UTSW 4 145536962 missense possibly damaging 0.86
Z1176:Zfp990 UTSW 4 145536811 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGCAGTGAATGTGACAAATGC -3'
(R):5'- TAGGCCAAAAGTAAAGGATTCATACCC -3'

Sequencing Primer
(F):5'- GCAGTGAATGTGACAAATGCTTTAC -3'
(R):5'- CTTGGAAAAGGATTGTCTCATTCAC -3'
Posted On2018-07-24