Incidental Mutation 'R6701:Guf1'
ID528733
Institutional Source Beutler Lab
Gene Symbol Guf1
Ensembl Gene ENSMUSG00000029208
Gene NameGUF1 homolog, GTPase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.713) question?
Stock #R6701 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location69556923-69575973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69558253 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 47 (D47E)
Ref Sequence ENSEMBL: ENSMUSP00000133467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031113] [ENSMUST00000087228] [ENSMUST00000132169] [ENSMUST00000144363] [ENSMUST00000154728] [ENSMUST00000173205]
Predicted Effect probably damaging
Transcript: ENSMUST00000031113
AA Change: D60E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031113
Gene: ENSMUSG00000029208
AA Change: D60E

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 2.9e-53 PFAM
Pfam:MMR_HSR1 52 177 1.1e-7 PFAM
Pfam:Ras 83 227 2.4e-7 PFAM
low complexity region 336 349 N/A INTRINSIC
EFG_C 364 450 9.13e-1 SMART
Pfam:LepA_C 452 559 3.1e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087228
AA Change: D60E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084480
Gene: ENSMUSG00000029208
AA Change: D60E

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 3.1e-54 PFAM
Pfam:MMR_HSR1 52 177 4.1e-6 PFAM
Pfam:Ras 83 226 2.9e-7 PFAM
Pfam:GTP_EFTU_D2 250 320 7e-10 PFAM
low complexity region 424 437 N/A INTRINSIC
EFG_C 452 538 9.13e-1 SMART
Pfam:LepA_C 540 646 1.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125543
Predicted Effect probably damaging
Transcript: ENSMUST00000132169
AA Change: D60E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144290
Gene: ENSMUSG00000029208
AA Change: D60E

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 6.2e-54 PFAM
Pfam:MMR_HSR1 52 177 6.2e-6 PFAM
Pfam:Ras 83 226 1.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144363
AA Change: D54E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114707
Gene: ENSMUSG00000029208
AA Change: D54E

DomainStartEndE-ValueType
low complexity region 1 23 N/A INTRINSIC
Pfam:GTP_EFTU 42 221 5.8e-54 PFAM
Pfam:MMR_HSR1 46 171 5.9e-6 PFAM
Pfam:Ras 77 220 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154728
AA Change: D60E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144246
Gene: ENSMUSG00000029208
AA Change: D60E

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 6.2e-54 PFAM
Pfam:MMR_HSR1 52 177 6.2e-6 PFAM
Pfam:Ras 83 226 1.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173205
AA Change: D47E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133467
Gene: ENSMUSG00000029208
AA Change: D47E

DomainStartEndE-ValueType
Pfam:GTP_EFTU 11 190 1.1e-53 PFAM
Pfam:MMR_HSR1 15 140 2.6e-8 PFAM
Pfam:Ras 46 190 1.6e-7 PFAM
Pfam:GTP_EFTU_D2 213 283 3.1e-9 PFAM
Pfam:EFG_C 369 454 1e-16 PFAM
Pfam:LepA_C 455 562 4.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201115
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase that triggers back-translocation of the elongating ribosome during mitochondrial protein synthesis. The protein contains a highly conserved C-terminal domain not found in other GTPases that facilitates tRNA binding. The encoded protein is thought to prevent misincorporation of amino acids in stressful, suboptimal conditions. An allelic variant in this gene has been associated with early infantile epileptic encephalopathy-40. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Arid4a A T 12: 71,087,512 K1196I probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Bfsp2 C T 9: 103,479,878 V117M possibly damaging Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Ddx21 T C 10: 62,590,691 Y461C probably damaging Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eml6 T A 11: 29,785,748 L1139F probably damaging Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Hsd17b1 C A 11: 101,080,155 C312* probably null Het
Ighg2b T C 12: 113,307,079 T144A unknown Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1009 A G 2: 85,722,331 K309E probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc35f5 T C 1: 125,562,610 V103A probably damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r67 G A 7: 85,152,815 P93S probably damaging Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Zfp990 A G 4: 145,538,178 D582G probably benign Het
Other mutations in Guf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01580:Guf1 APN 5 69565421 splice site probably benign
IGL01739:Guf1 APN 5 69561158 missense probably damaging 1.00
IGL03110:Guf1 APN 5 69558477 missense probably damaging 1.00
R0054:Guf1 UTSW 5 69559561 synonymous silent
R0219:Guf1 UTSW 5 69559586 missense probably damaging 1.00
R0269:Guf1 UTSW 5 69559599 missense probably damaging 0.99
R0624:Guf1 UTSW 5 69558580 missense probably damaging 1.00
R0690:Guf1 UTSW 5 69566352 intron probably null
R0906:Guf1 UTSW 5 69566386 missense probably damaging 0.99
R1082:Guf1 UTSW 5 69567212 missense possibly damaging 0.95
R1386:Guf1 UTSW 5 69563162 missense probably benign
R1506:Guf1 UTSW 5 69567166 missense possibly damaging 0.85
R1859:Guf1 UTSW 5 69568460 nonsense probably null
R1982:Guf1 UTSW 5 69567226 nonsense probably null
R3782:Guf1 UTSW 5 69567152 missense probably benign 0.01
R3847:Guf1 UTSW 5 69561157 missense probably damaging 0.99
R4172:Guf1 UTSW 5 69558229 missense possibly damaging 0.88
R4513:Guf1 UTSW 5 69561662 missense probably benign 0.00
R4592:Guf1 UTSW 5 69566443 missense possibly damaging 0.55
R4811:Guf1 UTSW 5 69564509 splice site probably null
R5435:Guf1 UTSW 5 69563169 missense probably benign 0.01
R5792:Guf1 UTSW 5 69560486 missense probably damaging 1.00
R6181:Guf1 UTSW 5 69561716 missense probably damaging 1.00
R6246:Guf1 UTSW 5 69558555 missense probably damaging 1.00
R6411:Guf1 UTSW 5 69560511 missense possibly damaging 0.87
R6724:Guf1 UTSW 5 69566393 missense probably damaging 0.99
R7634:Guf1 UTSW 5 69564544 missense probably damaging 0.97
X0018:Guf1 UTSW 5 69566366 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACGTGAAGTTGTCCATCGATG -3'
(R):5'- TGCGCCTTCACAGTGATTCC -3'

Sequencing Primer
(F):5'- CCCTTCTTAGGAGAAACCTG -3'
(R):5'- AAGAACCTGCTTGTTTTTCTTCG -3'
Posted On2018-07-24