Mutagenetix > Incidental Mutation

Incidental Mutation 'R6701:Dysf'

528741

Institutional Source

Beutler Lab

Gene Symbol

Dysf

Ensembl Gene

ENSMUSG00000033788

Gene Name

dysferlin

Synonyms

2310004N10Rik

MMRRC Submission

044819-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6701 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84008590-84211060 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 84112190 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 912 (G912S)

Ref Sequence

ENSEMBL: ENSMUSP00000144705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081904] [ENSMUST00000089595] [ENSMUST00000113818] [ENSMUST00000113821] [ENSMUST00000113823] [ENSMUST00000153860] [ENSMUST00000168387] [ENSMUST00000203695] [ENSMUST00000203803] [ENSMUST00000204354] [ENSMUST00000204591] [ENSMUST00000204987]

AlphaFold

Q9ESD7

Predicted Effect

probably damaging
Transcript: ENSMUST00000081904
AA Change: G943S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080579
Gene: ENSMUSG00000033788
AA Change: G943S

Domain	Start	End	E-Value	Type
C2	1	101	2.11e-14	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	213	232	N/A	INTRINSIC
C2	255	351	4.84e-14	SMART
FerI	337	408	5.3e-39	SMART
C2	414	528	2.96e-9	SMART
FerA	714	779	6.3e-23	SMART
FerB	806	880	2.49e-44	SMART
DysFN	894	953	1.42e-22	SMART
DysFN	966	1022	2.65e-22	SMART
DysFC	1031	1069	1.33e-13	SMART
DysFC	1088	1121	1.1e-10	SMART
C2	1173	1281	2.63e-15	SMART
C2	1350	1457	7.13e0	SMART
C2	1599	1698	2.52e-12	SMART
C2	1832	1961	1.55e-3	SMART
Pfam:Ferlin_C	1991	2095	6.7e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089595
AA Change: G926S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087022
Gene: ENSMUSG00000033788
AA Change: G926S

Domain	Start	End	E-Value	Type
C2	1	101	2.11e-14	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	182	201	N/A	INTRINSIC
C2	224	320	4.84e-14	SMART
FerI	306	377	5.3e-39	SMART
C2	383	497	1.12e-9	SMART
FerA	697	762	6.3e-23	SMART
FerB	789	863	2.49e-44	SMART
DysFN	877	936	1.42e-22	SMART
DysFN	949	1005	2.65e-22	SMART
DysFC	1014	1052	1.33e-13	SMART
DysFC	1071	1104	1.1e-10	SMART
C2	1156	1264	2.63e-15	SMART
C2	1333	1440	7.13e0	SMART
C2	1582	1681	2.52e-12	SMART
C2	1815	1944	1.55e-3	SMART
Pfam:Ferlin_C	1974	2078	3.7e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113818
AA Change: G912S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109449
Gene: ENSMUSG00000033788
AA Change: G912S

Domain	Start	End	E-Value	Type
C2	1	101	2.11e-14	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	182	201	N/A	INTRINSIC
C2	224	320	4.84e-14	SMART
FerI	306	377	5.3e-39	SMART
C2	383	497	2.96e-9	SMART
FerA	683	748	6.3e-23	SMART
FerB	775	849	2.49e-44	SMART
DysFN	863	922	1.42e-22	SMART
DysFN	935	991	2.65e-22	SMART
DysFC	1000	1038	1.33e-13	SMART
DysFC	1057	1090	1.1e-10	SMART
C2	1142	1250	2.63e-15	SMART
C2	1319	1426	7.13e0	SMART
C2	1568	1667	2.52e-12	SMART
C2	1801	1930	1.55e-3	SMART
transmembrane domain	2034	2056	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113821
AA Change: G925S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109452
Gene: ENSMUSG00000033788
AA Change: G925S

Domain	Start	End	E-Value	Type
C2	1	100	1.62e-15	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	181	200	N/A	INTRINSIC
C2	223	319	4.84e-14	SMART
FerI	305	376	5.3e-39	SMART
C2	382	496	1.12e-9	SMART
FerA	696	761	6.3e-23	SMART
FerB	788	862	2.49e-44	SMART
DysFN	876	935	1.42e-22	SMART
DysFN	948	1004	2.65e-22	SMART
DysFC	1013	1051	1.33e-13	SMART
DysFC	1070	1103	1.1e-10	SMART
C2	1155	1263	2.63e-15	SMART
C2	1332	1439	7.13e0	SMART
C2	1581	1680	2.52e-12	SMART
C2	1814	1943	1.55e-3	SMART
transmembrane domain	2047	2069	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113823
AA Change: G942S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109454
Gene: ENSMUSG00000033788
AA Change: G942S

Domain	Start	End	E-Value	Type
C2	1	100	1.62e-15	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	212	231	N/A	INTRINSIC
C2	254	350	4.84e-14	SMART
FerI	336	407	5.3e-39	SMART
C2	413	527	2.96e-9	SMART
FerA	713	778	6.3e-23	SMART
FerB	805	879	2.49e-44	SMART
DysFN	893	952	1.42e-22	SMART
DysFN	965	1021	2.65e-22	SMART
DysFC	1030	1068	1.33e-13	SMART
DysFC	1087	1120	1.1e-10	SMART
C2	1172	1280	2.63e-15	SMART
C2	1349	1456	7.13e0	SMART
C2	1598	1697	2.52e-12	SMART
C2	1831	1960	1.55e-3	SMART
transmembrane domain	2064	2086	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127459

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152646

Predicted Effect

probably damaging
Transcript: ENSMUST00000153860
AA Change: G925S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145518
Gene: ENSMUSG00000033788
AA Change: G925S

Domain	Start	End	E-Value	Type
C2	1	100	1.1e-17	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	181	200	N/A	INTRINSIC
C2	223	319	3.2e-16	SMART
FerI	305	376	2.6e-43	SMART
C2	382	496	7.4e-12	SMART
FerA	696	761	3.1e-27	SMART
FerB	788	862	1.2e-48	SMART
DysFN	876	935	5.3e-25	SMART
DysFN	948	1004	9.6e-25	SMART
DysFC	1013	1051	4.7e-16	SMART
DysFC	1070	1103	4.1e-13	SMART
C2	1155	1263	1.7e-17	SMART
C2	1332	1439	4.7e-2	SMART
C2	1602	1701	1.7e-14	SMART
C2	1835	1964	1.1e-5	SMART
Pfam:Ferlin_C	1994	2098	4.4e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000168387
AA Change: G933S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132297
Gene: ENSMUSG00000033788
AA Change: G933S

Domain	Start	End	E-Value	Type
C2	1	100	1.62e-15	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	181	200	N/A	INTRINSIC
C2	223	319	4.84e-14	SMART
FerI	305	376	5.3e-39	SMART
C2	382	496	1.12e-9	SMART
FerA	704	769	6.3e-23	SMART
FerB	796	870	2.49e-44	SMART
DysFN	884	943	1.42e-22	SMART
DysFN	956	1012	2.65e-22	SMART
DysFC	1021	1059	1.33e-13	SMART
DysFC	1078	1111	1.1e-10	SMART
C2	1163	1271	2.63e-15	SMART
C2	1340	1447	7.13e0	SMART
C2	1589	1688	2.52e-12	SMART
C2	1822	1951	1.55e-3	SMART
transmembrane domain	2055	2077	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000203695
AA Change: G957S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000145292
Gene: ENSMUSG00000033788
AA Change: G957S

Domain	Start	End	E-Value	Type
C2	1	101	1.4e-16	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	213	232	N/A	INTRINSIC
C2	255	351	3.2e-16	SMART
FerI	337	408	2.6e-43	SMART
C2	414	528	7.4e-12	SMART
FerA	728	793	3.1e-27	SMART
FerB	820	894	1.2e-48	SMART
DysFN	908	967	5.3e-25	SMART
DysFN	980	1036	9.6e-25	SMART
DysFC	1045	1083	4.7e-16	SMART
DysFC	1102	1135	4.1e-13	SMART
C2	1187	1295	1.7e-17	SMART
C2	1364	1471	4.7e-2	SMART
C2	1613	1712	1.7e-14	SMART
C2	1846	1975	1.1e-5	SMART
Pfam:Ferlin_C	2005	2109	4.4e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203803
AA Change: G956S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000145511
Gene: ENSMUSG00000033788
AA Change: G956S

Domain	Start	End	E-Value	Type
C2	1	100	1.1e-17	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	212	231	N/A	INTRINSIC
C2	254	350	3.2e-16	SMART
FerI	336	407	2.6e-43	SMART
C2	413	527	7.4e-12	SMART
FerA	727	792	3.1e-27	SMART
FerB	819	893	1.2e-48	SMART
DysFN	907	966	5.3e-25	SMART
DysFN	979	1035	9.6e-25	SMART
DysFC	1044	1082	4.7e-16	SMART
DysFC	1101	1134	4.1e-13	SMART
C2	1186	1294	1.7e-17	SMART
C2	1353	1460	4.7e-2	SMART
C2	1602	1701	1.7e-14	SMART
C2	1835	1964	1.1e-5	SMART
Pfam:Ferlin_C	1994	2098	4.4e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000204354
AA Change: G912S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144705
Gene: ENSMUSG00000033788
AA Change: G912S

Domain	Start	End	E-Value	Type
C2	1	101	1.4e-16	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	182	201	N/A	INTRINSIC
C2	224	320	3.2e-16	SMART
FerI	306	377	2.6e-43	SMART
C2	383	497	2e-11	SMART
FerA	683	748	3.1e-27	SMART
FerB	775	849	1.2e-48	SMART
DysFN	863	922	5.3e-25	SMART
DysFN	935	991	9.6e-25	SMART
DysFC	1000	1038	4.7e-16	SMART
DysFC	1057	1090	4.1e-13	SMART
C2	1142	1250	1.7e-17	SMART
C2	1319	1426	4.7e-2	SMART
C2	1589	1688	1.7e-14	SMART
C2	1822	1951	1.1e-5	SMART
Pfam:Ferlin_C	1981	2085	4.4e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000204591
AA Change: G942S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144970
Gene: ENSMUSG00000033788
AA Change: G942S

Domain	Start	End	E-Value	Type
C2	1	100	1.1e-17	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	212	231	N/A	INTRINSIC
C2	254	350	3.2e-16	SMART
FerI	336	407	2.6e-43	SMART
C2	413	527	2e-11	SMART
FerA	713	778	3.1e-27	SMART
FerB	805	879	1.2e-48	SMART
DysFN	893	952	5.3e-25	SMART
DysFN	965	1021	9.6e-25	SMART
DysFC	1030	1068	4.7e-16	SMART
DysFC	1087	1120	4.1e-13	SMART
C2	1172	1280	1.7e-17	SMART
C2	1349	1456	4.7e-2	SMART
C2	1619	1718	1.7e-14	SMART
C2	1852	1981	1.1e-5	SMART
Pfam:Ferlin_C	2011	2115	4.4e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000204987
AA Change: G926S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144748
Gene: ENSMUSG00000033788
AA Change: G926S

Domain	Start	End	E-Value	Type
C2	1	101	1.4e-16	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	182	201	N/A	INTRINSIC
C2	224	320	3.2e-16	SMART
FerI	306	377	2.6e-43	SMART
C2	383	497	7.4e-12	SMART
FerA	697	762	3.1e-27	SMART
FerB	789	863	1.2e-48	SMART
DysFN	877	936	5.3e-25	SMART
DysFN	949	1005	9.6e-25	SMART
DysFC	1014	1052	4.7e-16	SMART
DysFC	1071	1104	4.1e-13	SMART
C2	1156	1264	1.7e-17	SMART
C2	1333	1440	4.7e-2	SMART
C2	1603	1702	1.7e-14	SMART
C2	1836	1965	1.1e-5	SMART
Pfam:Ferlin_C	1995	2099	4.4e-22	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes display dystrophic muscle changes and progressive muscle weakness developing over time. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap12	A	T	10: 4,355,243	K684N	probably damaging	Het
Akna	C	T	4: 63,395,280	G202D	probably benign	Het
Alpk1	T	A	3: 127,729,336	D19V	probably damaging	Het
Arid4a	A	T	12: 71,087,512	K1196I	probably damaging	Het
Asic3	A	T	5: 24,414,129	M140L	possibly damaging	Het
BC055324	T	C	1: 163,971,843		probably null	Het
Bfsp2	C	T	9: 103,479,878	V117M	possibly damaging	Het
Cd244	C	A	1: 171,574,155	L150M	possibly damaging	Het
Cd3e	T	C	9: 45,001,053	Y131C	probably damaging	Het
Clptm1l	T	C	13: 73,608,906	I202T	probably benign	Het
Cnot4	G	T	6: 35,068,604	T224K	probably damaging	Het
Col24a1	A	G	3: 145,314,380	T171A	probably benign	Het
Col6a3	C	T	1: 90,792,462	R1552Q	probably benign	Het
Dcc	T	A	18: 71,809,120	T309S	probably benign	Het
Ddx21	T	C	10: 62,590,691	Y461C	probably damaging	Het
Dnah10	G	A	5: 124,760,159	V989M	probably benign	Het
Dppa4	A	T	16: 48,291,311	K220*	probably null	Het
Efhb	A	T	17: 53,399,063	N815K	probably benign	Het
Eml6	T	A	11: 29,785,748	L1139F	probably damaging	Het
Eprs	T	G	1: 185,370,890	I78S	probably damaging	Het
Fat1	C	A	8: 44,950,681	S156R	probably damaging	Het
Frzb	G	A	2: 80,446,819	R8W	possibly damaging	Het
Guf1	T	A	5: 69,558,253	D47E	probably damaging	Het
Haus3	A	T	5: 34,167,734	F194I	probably damaging	Het
Hivep3	C	T	4: 120,094,540	R18W	probably damaging	Het
Hnf1b	A	G	11: 83,889,094	T392A	probably damaging	Het
Hsd17b1	C	A	11: 101,080,155	C312*	probably null	Het
Ighg2b	T	C	12: 113,307,079	T144A	unknown	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Jhy	T	C	9: 40,917,591	R340G	probably damaging	Het
Klra3	C	G	6: 130,330,253	V144L	probably benign	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Lrmp	G	T	6: 145,144,976	E61*	probably null	Het
Lrrc4	A	G	6: 28,830,906	F237L	possibly damaging	Het
Lyst	T	A	13: 13,681,485	C2464S	probably benign	Het
Maml1	T	C	11: 50,266,682	E222G	probably damaging	Het
Med15	C	T	16: 17,671,583		probably benign	Het
Naalad2	T	C	9: 18,385,148	I69V	probably null	Het
Neb	T	C	2: 52,291,208	K1129R	probably damaging	Het
Nsun6	A	T	2: 15,036,302	N159K	probably benign	Het
Nup153	A	T	13: 46,687,065	N1022K	probably benign	Het
Olfr1009	A	G	2: 85,722,331	K309E	probably benign	Het
Olfr1138	C	T	2: 87,737,409	R305K	probably benign	Het
Olfr389	T	C	11: 73,776,470	N286D	probably damaging	Het
Otof	T	A	5: 30,370,797	K1901*	probably null	Het
Pde1c	A	T	6: 56,181,700	Y136N	probably damaging	Het
Phc1	G	T	6: 122,325,774	N263K	probably damaging	Het
Plxna1	A	T	6: 89,319,448	D1871E	probably damaging	Het
Prdm6	T	A	18: 53,536,679	M123K	possibly damaging	Het
Ranbp17	T	C	11: 33,475,066	D430G	probably damaging	Het
Rsl24d1	C	A	9: 73,114,997	T287K	probably damaging	Het
Scn1a	G	A	2: 66,337,960	R101W	probably damaging	Het
Scn8a	A	G	15: 101,040,096	D1741G	probably damaging	Het
Serpinb1c	T	C	13: 32,896,941	Q53R	probably benign	Het
Serpinf2	C	T	11: 75,432,443	R479H	probably damaging	Het
Sis	T	A	3: 72,949,527	D448V	probably damaging	Het
Slc27a6	T	A	18: 58,579,875	D256E	probably benign	Het
Slc30a8	A	G	15: 52,331,574	Y243C	possibly damaging	Het
Slc35f5	T	C	1: 125,562,610	V103A	probably damaging	Het
Slc44a2	T	C	9: 21,320,853		probably null	Het
Slc7a9	T	C	7: 35,459,849	L327P	probably damaging	Het
Stat4	A	G	1: 52,102,974	Y660C	probably damaging	Het
Terb1	T	C	8: 104,472,756	T519A	possibly damaging	Het
Tonsl	A	T	15: 76,629,300	S1245T	probably damaging	Het
Ttn	A	T	2: 76,788,818	S16072R	probably damaging	Het
Ttn	A	T	2: 76,909,246	Y3650N	probably benign	Het
Uhrf1bp1	T	A	17: 27,887,357	C952*	probably null	Het
Uso1	T	C	5: 92,166,585	F117S	probably damaging	Het
Vmn1r211	T	C	13: 22,851,609	H296R	probably benign	Het
Vmn2r67	G	A	7: 85,152,815	P93S	probably damaging	Het
Xirp2	A	T	2: 67,516,225	I2937F	possibly damaging	Het
Zc2hc1c	C	A	12: 85,289,672		probably null	Het
Zfp12	T	C	5: 143,244,464	V182A	probably benign	Het
Zfp473	G	T	7: 44,732,794	A705D	possibly damaging	Het
Zfp937	G	T	2: 150,239,216	G389C	probably damaging	Het
Zfp990	A	G	4: 145,538,178	D582G	probably benign	Het

Other mutations in Dysf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Dysf	APN	6	84108099	missense	probably damaging	1.00
IGL00340:Dysf	APN	6	84141951	missense	probably benign	0.02
IGL00429:Dysf	APN	6	84189844	missense	probably damaging	1.00
IGL00465:Dysf	APN	6	84199848	critical splice donor site	probably null
IGL00800:Dysf	APN	6	84149998	missense	probably damaging	1.00
IGL01069:Dysf	APN	6	84199785	missense	possibly damaging	0.94
IGL01094:Dysf	APN	6	84194386	missense	probably damaging	1.00
IGL01420:Dysf	APN	6	84149759	nonsense	probably null
IGL01649:Dysf	APN	6	84199839	missense	probably damaging	1.00
IGL01923:Dysf	APN	6	84210829	makesense	probably null
IGL01991:Dysf	APN	6	84113618	missense	probably damaging	1.00
IGL01999:Dysf	APN	6	84113618	missense	probably damaging	1.00
IGL02002:Dysf	APN	6	84210787	splice site	probably benign
IGL02136:Dysf	APN	6	84108167	missense	probably benign	0.43
IGL02318:Dysf	APN	6	84186464	missense	possibly damaging	0.50
IGL02378:Dysf	APN	6	84111905	missense	probably damaging	1.00
IGL02404:Dysf	APN	6	84116061	missense	probably damaging	1.00
IGL02416:Dysf	APN	6	84192914	missense	possibly damaging	0.92
IGL02535:Dysf	APN	6	84149697	missense	possibly damaging	0.45
IGL02553:Dysf	APN	6	84130127	missense	possibly damaging	0.95
IGL02559:Dysf	APN	6	84067446	splice site	probably benign
IGL02563:Dysf	APN	6	84186516	splice site	probably benign
IGL02647:Dysf	APN	6	84137373	missense	probably damaging	1.00
IGL02820:Dysf	APN	6	84100205	missense	probably damaging	0.99
IGL02858:Dysf	APN	6	84099489	missense	probably benign	0.01
IGL02860:Dysf	APN	6	84190898	critical splice donor site	probably null
IGL02861:Dysf	APN	6	84039537	missense	probably damaging	0.99
IGL03008:Dysf	APN	6	84073894	missense	probably benign	0.01
IGL03023:Dysf	APN	6	84193007	missense	probably damaging	1.00
IGL03074:Dysf	APN	6	84188226	missense	probably benign	0.25
IGL03342:Dysf	APN	6	84190872	missense	probably benign
PIT4305001:Dysf	UTSW	6	84100234	nonsense	probably null
R0067:Dysf	UTSW	6	84063331	missense	possibly damaging	0.58
R0106:Dysf	UTSW	6	84113336	missense	probably benign	0.07
R0106:Dysf	UTSW	6	84113336	missense	probably benign	0.07
R0124:Dysf	UTSW	6	84065102	splice site	probably benign
R0219:Dysf	UTSW	6	84129461	splice site	probably benign
R0238:Dysf	UTSW	6	84064479	nonsense	probably null
R0238:Dysf	UTSW	6	84064479	nonsense	probably null
R0239:Dysf	UTSW	6	84064479	nonsense	probably null
R0239:Dysf	UTSW	6	84064479	nonsense	probably null
R0426:Dysf	UTSW	6	84149757	missense	probably damaging	1.00
R0455:Dysf	UTSW	6	84140667	missense	probably benign	0.29
R0482:Dysf	UTSW	6	84152405	missense	probably benign	0.03
R0545:Dysf	UTSW	6	84099461	missense	probably damaging	0.99
R0625:Dysf	UTSW	6	84111987	splice site	probably null
R0676:Dysf	UTSW	6	84113336	missense	probably benign	0.07
R0699:Dysf	UTSW	6	84190846	missense	probably benign	0.00
R1165:Dysf	UTSW	6	84067069	missense	probably damaging	0.98
R1455:Dysf	UTSW	6	84113386	missense	probably benign	0.01
R1582:Dysf	UTSW	6	84097767	missense	probably damaging	1.00
R1584:Dysf	UTSW	6	84067047	missense	probably benign	0.04
R1605:Dysf	UTSW	6	84106941	missense	probably damaging	0.96
R1674:Dysf	UTSW	6	84179715	missense	probably benign	0.01
R1739:Dysf	UTSW	6	84112235	critical splice donor site	probably null
R1765:Dysf	UTSW	6	84190902	splice site	probably null
R1813:Dysf	UTSW	6	84151924	missense	possibly damaging	0.83
R1900:Dysf	UTSW	6	84039567	missense	probably damaging	0.97
R1960:Dysf	UTSW	6	84073903	missense	probably benign	0.12
R2216:Dysf	UTSW	6	84207245	splice site	probably null
R2242:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2243:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2245:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2246:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2280:Dysf	UTSW	6	84064494	missense	probably damaging	0.99
R2374:Dysf	UTSW	6	84097729	missense	probably damaging	1.00
R2403:Dysf	UTSW	6	84039567	missense	possibly damaging	0.84
R2763:Dysf	UTSW	6	84106932	missense	probably benign	0.00
R2895:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2916:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2918:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3402:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3403:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3434:Dysf	UTSW	6	84070888	missense	probably benign	0.00
R3772:Dysf	UTSW	6	84152351	missense	possibly damaging	0.63
R3781:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3789:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3822:Dysf	UTSW	6	84207088	splice site	probably benign
R3918:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3919:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3939:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3942:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R4177:Dysf	UTSW	6	84067031	nonsense	probably null
R4179:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R4180:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R4299:Dysf	UTSW	6	84068077	missense	possibly damaging	0.78
R4419:Dysf	UTSW	6	84207242	critical splice donor site	probably null
R4446:Dysf	UTSW	6	84205872	missense	probably damaging	1.00
R4577:Dysf	UTSW	6	84137326	missense	probably damaging	1.00
R4680:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4708:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4709:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4710:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4725:Dysf	UTSW	6	84097756	missense	probably damaging	1.00
R4742:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4743:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4749:Dysf	UTSW	6	84067008	missense	probably damaging	1.00
R4787:Dysf	UTSW	6	84203328	nonsense	probably null
R4850:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4868:Dysf	UTSW	6	84179693	missense	probably damaging	1.00
R4871:Dysf	UTSW	6	84067023	missense	possibly damaging	0.93
R4951:Dysf	UTSW	6	84114120	critical splice donor site	probably null
R4952:Dysf	UTSW	6	84149986	missense	possibly damaging	0.79
R5009:Dysf	UTSW	6	84151986	missense	probably damaging	1.00
R5072:Dysf	UTSW	6	84137272	missense	probably damaging	1.00
R5073:Dysf	UTSW	6	84137272	missense	probably damaging	1.00
R5074:Dysf	UTSW	6	84137272	missense	probably damaging	1.00
R5252:Dysf	UTSW	6	84186468	missense	probably damaging	0.98
R5260:Dysf	UTSW	6	84150034	missense	probably damaging	1.00
R5447:Dysf	UTSW	6	84195263	missense	probably damaging	0.98
R5501:Dysf	UTSW	6	84087818	missense	probably damaging	0.99
R5533:Dysf	UTSW	6	84186471	missense	probably damaging	0.99
R5611:Dysf	UTSW	6	84064878	missense	probably damaging	0.98
R5618:Dysf	UTSW	6	84106824	missense	probably benign	0.03
R5884:Dysf	UTSW	6	84186081	missense	probably damaging	1.00
R5927:Dysf	UTSW	6	84207212	missense	probably damaging	1.00
R6045:Dysf	UTSW	6	84114072	missense	probably damaging	0.99
R6056:Dysf	UTSW	6	84106862	missense	probably benign
R6084:Dysf	UTSW	6	84019604	missense	probably damaging	0.98
R6084:Dysf	UTSW	6	84112119	missense	probably damaging	1.00
R6146:Dysf	UTSW	6	84203199	missense	probably damaging	0.96
R6220:Dysf	UTSW	6	84149745	missense	probably damaging	0.97
R6232:Dysf	UTSW	6	84098253	missense	probably benign	0.26
R6247:Dysf	UTSW	6	84066999	missense	probably damaging	1.00
R6298:Dysf	UTSW	6	84107136	splice site	probably null
R6306:Dysf	UTSW	6	84137266	missense	possibly damaging	0.91
R6377:Dysf	UTSW	6	84008963	missense	probably benign
R6415:Dysf	UTSW	6	84140042	missense	probably damaging	1.00
R6444:Dysf	UTSW	6	84190840	missense	probably benign	0.36
R6470:Dysf	UTSW	6	84066944	missense	possibly damaging	0.93
R6504:Dysf	UTSW	6	84008925	missense	probably benign	0.03
R6557:Dysf	UTSW	6	84186384	missense	probably damaging	0.99
R6665:Dysf	UTSW	6	84130116	missense	probably benign
R6776:Dysf	UTSW	6	84064894	missense	possibly damaging	0.88
R6909:Dysf	UTSW	6	84192938	missense	probably damaging	1.00
R7007:Dysf	UTSW	6	84113980	missense	probably damaging	1.00
R7013:Dysf	UTSW	6	84137358	missense	probably damaging	1.00
R7035:Dysf	UTSW	6	84186392	missense	probably benign	0.02
R7094:Dysf	UTSW	6	84100202	missense	probably benign	0.43
R7124:Dysf	UTSW	6	84190901	splice site	probably null
R7156:Dysf	UTSW	6	84087876	critical splice donor site	probably null
R7261:Dysf	UTSW	6	84193010	missense	probably damaging	0.98
R7296:Dysf	UTSW	6	84106898	missense	probably benign	0.33
R7356:Dysf	UTSW	6	84067461	missense	probably damaging	1.00
R7359:Dysf	UTSW	6	84195324	splice site	probably null
R7384:Dysf	UTSW	6	84114105	missense	probably benign	0.17
R7409:Dysf	UTSW	6	84149682	missense	probably benign	0.00
R7449:Dysf	UTSW	6	84137380	missense	possibly damaging	0.90
R7476:Dysf	UTSW	6	84064896	missense	probably benign	0.08
R7496:Dysf	UTSW	6	84067478	missense	probably benign	0.43
R7573:Dysf	UTSW	6	84130122	missense	possibly damaging	0.59
R7616:Dysf	UTSW	6	84101963	missense	probably benign	0.01
R7684:Dysf	UTSW	6	84100135	missense	probably benign	0.00
R7808:Dysf	UTSW	6	84070929	missense	possibly damaging	0.86
R7836:Dysf	UTSW	6	84137398	missense	probably damaging	1.00
R7868:Dysf	UTSW	6	84114099	missense	probably benign	0.00
R7873:Dysf	UTSW	6	84083765	missense	probably benign
R7956:Dysf	UTSW	6	84008996	missense	probably benign	0.01
R8130:Dysf	UTSW	6	84137376	missense	probably damaging	0.97
R8357:Dysf	UTSW	6	84188245	missense	probably benign	0.01
R8383:Dysf	UTSW	6	84019583	missense	probably damaging	1.00
R8457:Dysf	UTSW	6	84188245	missense	probably benign	0.01
R8693:Dysf	UTSW	6	84111970	missense	probably damaging	1.00
R8738:Dysf	UTSW	6	84194371	missense	probably damaging	1.00
R8808:Dysf	UTSW	6	84019484	start gained	probably benign
R8836:Dysf	UTSW	6	84116123	missense	probably damaging	1.00
R8915:Dysf	UTSW	6	84179754	missense	probably benign
R8959:Dysf	UTSW	6	84101963	missense	probably benign	0.01
R9091:Dysf	UTSW	6	84100234	nonsense	probably null
R9095:Dysf	UTSW	6	84179684	missense	probably benign	0.01
R9162:Dysf	UTSW	6	84112233	missense	probably damaging	1.00
R9164:Dysf	UTSW	6	84203326	missense	probably damaging	1.00
R9166:Dysf	UTSW	6	84149977	missense	probably damaging	1.00
R9173:Dysf	UTSW	6	84194397	missense	probably benign	0.10
R9191:Dysf	UTSW	6	84068066	missense	probably benign	0.43
R9270:Dysf	UTSW	6	84100234	nonsense	probably null
R9328:Dysf	UTSW	6	84073913	missense	probably damaging	1.00
R9470:Dysf	UTSW	6	84113370	missense	possibly damaging	0.59
R9509:Dysf	UTSW	6	84210797	missense	probably damaging	0.98
R9511:Dysf	UTSW	6	84113668	missense	probably damaging	1.00
R9526:Dysf	UTSW	6	84151903	missense	probably damaging	0.99
R9751:Dysf	UTSW	6	84186468	missense	probably damaging	0.98
X0063:Dysf	UTSW	6	84063354	missense	probably damaging	0.97
X0066:Dysf	UTSW	6	84114102	missense	possibly damaging	0.77
Z1176:Dysf	UTSW	6	84072685	missense	probably damaging	1.00
Z1177:Dysf	UTSW	6	84064523	missense	probably benign
Z1177:Dysf	UTSW	6	84087817	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- AAACGGTGAGTGCCTGCTAG -3'
(R):5'- GTGAGCTATTCCTGCTAAGCC -3'

Sequencing Primer
(F):5'- TGAGTGCCTGCTAGCCTACTG -3'
(R):5'- ATTCCTGCTAAGCCCCAGC -3'

Posted On

2018-07-24