Incidental Mutation 'R6701:Vmn2r67'
ID528748
Institutional Source Beutler Lab
Gene Symbol Vmn2r67
Ensembl Gene ENSMUSG00000095664
Gene Namevomeronasal 2, receptor 67
SynonymsEG620672
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6701 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location85136240-85155902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85152815 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 93 (P93S)
Ref Sequence ENSEMBL: ENSMUSP00000126007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168730]
Predicted Effect probably damaging
Transcript: ENSMUST00000168730
AA Change: P93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126007
Gene: ENSMUSG00000095664
AA Change: P93S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 464 2.1e-31 PFAM
Pfam:NCD3G 507 559 4.8e-19 PFAM
Pfam:7tm_3 590 827 1.4e-53 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Arid4a A T 12: 71,087,512 K1196I probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Bfsp2 C T 9: 103,479,878 V117M possibly damaging Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Ddx21 T C 10: 62,590,691 Y461C probably damaging Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eml6 T A 11: 29,785,748 L1139F probably damaging Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Guf1 T A 5: 69,558,253 D47E probably damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Hsd17b1 C A 11: 101,080,155 C312* probably null Het
Ighg2b T C 12: 113,307,079 T144A unknown Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1009 A G 2: 85,722,331 K309E probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc35f5 T C 1: 125,562,610 V103A probably damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Zfp990 A G 4: 145,538,178 D582G probably benign Het
Other mutations in Vmn2r67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Vmn2r67 APN 7 85151930 missense probably damaging 1.00
IGL01346:Vmn2r67 APN 7 85136919 missense probably damaging 1.00
IGL01373:Vmn2r67 APN 7 85136626 missense probably benign 0.10
IGL01674:Vmn2r67 APN 7 85136443 missense probably damaging 1.00
IGL01978:Vmn2r67 APN 7 85151441 critical splice donor site probably null
IGL02013:Vmn2r67 APN 7 85151655 missense probably benign 0.09
IGL02115:Vmn2r67 APN 7 85151579 missense probably damaging 0.99
IGL02250:Vmn2r67 APN 7 85155800 missense probably benign
IGL02252:Vmn2r67 APN 7 85155800 missense probably benign
IGL02328:Vmn2r67 APN 7 85150690 missense probably benign 0.41
IGL02740:Vmn2r67 APN 7 85136610 missense probably damaging 1.00
IGL02940:Vmn2r67 APN 7 85136743 missense probably benign 0.07
IGL03237:Vmn2r67 APN 7 85149910 missense probably damaging 1.00
R0512:Vmn2r67 UTSW 7 85150692 missense probably damaging 1.00
R1029:Vmn2r67 UTSW 7 85136766 missense probably damaging 1.00
R1193:Vmn2r67 UTSW 7 85151445 missense probably damaging 0.98
R1282:Vmn2r67 UTSW 7 85136724 missense probably benign
R1416:Vmn2r67 UTSW 7 85151616 missense probably benign 0.06
R1429:Vmn2r67 UTSW 7 85152823 missense possibly damaging 0.65
R1462:Vmn2r67 UTSW 7 85155838 missense probably benign 0.00
R1462:Vmn2r67 UTSW 7 85155838 missense probably benign 0.00
R1970:Vmn2r67 UTSW 7 85151805 missense probably benign
R2229:Vmn2r67 UTSW 7 85152042 missense probably benign 0.21
R2246:Vmn2r67 UTSW 7 85136556 missense probably damaging 1.00
R2262:Vmn2r67 UTSW 7 85136974 missense probably damaging 0.96
R2398:Vmn2r67 UTSW 7 85136713 missense probably damaging 1.00
R4249:Vmn2r67 UTSW 7 85150514 splice site probably null
R4666:Vmn2r67 UTSW 7 85150623 missense probably benign
R4669:Vmn2r67 UTSW 7 85150524 missense probably benign 0.11
R4966:Vmn2r67 UTSW 7 85136385 missense probably damaging 1.00
R5264:Vmn2r67 UTSW 7 85152245 missense probably damaging 1.00
R5296:Vmn2r67 UTSW 7 85137022 missense probably damaging 1.00
R5327:Vmn2r67 UTSW 7 85136490 missense probably damaging 1.00
R5401:Vmn2r67 UTSW 7 85136557 missense probably damaging 1.00
R5510:Vmn2r67 UTSW 7 85151815 missense probably benign 0.39
R5574:Vmn2r67 UTSW 7 85151891 missense probably benign 0.00
R5643:Vmn2r67 UTSW 7 85149943 nonsense probably null
R5914:Vmn2r67 UTSW 7 85151836 missense probably damaging 1.00
R6248:Vmn2r67 UTSW 7 85150560 missense probably damaging 0.99
R6291:Vmn2r67 UTSW 7 85149934 missense possibly damaging 0.88
R6309:Vmn2r67 UTSW 7 85151916 missense probably benign
R6442:Vmn2r67 UTSW 7 85155838 missense possibly damaging 0.82
R6665:Vmn2r67 UTSW 7 85136692 missense probably benign 0.07
R6848:Vmn2r67 UTSW 7 85152632 missense probably benign 0.00
R6852:Vmn2r67 UTSW 7 85152153 missense probably damaging 0.99
R6991:Vmn2r67 UTSW 7 85155745 missense possibly damaging 0.55
R7143:Vmn2r67 UTSW 7 85152638 missense probably benign
R7197:Vmn2r67 UTSW 7 85136566 missense possibly damaging 0.77
R7393:Vmn2r67 UTSW 7 85155878 missense probably null 0.87
R7420:Vmn2r67 UTSW 7 85136736 missense possibly damaging 0.52
R7622:Vmn2r67 UTSW 7 85136454 missense probably damaging 1.00
R7664:Vmn2r67 UTSW 7 85155811 missense probably benign 0.21
R7665:Vmn2r67 UTSW 7 85151988 nonsense probably null
R7896:Vmn2r67 UTSW 7 85136712 missense probably damaging 1.00
R7913:Vmn2r67 UTSW 7 85151828 missense possibly damaging 0.87
R7979:Vmn2r67 UTSW 7 85136712 missense probably damaging 1.00
R7994:Vmn2r67 UTSW 7 85151828 missense possibly damaging 0.87
R8026:Vmn2r67 UTSW 7 85136716 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTACCTCAGGAATGCTATAC -3'
(R):5'- CCCTTTTCTGTCAGTTAAAACCAG -3'

Sequencing Primer
(F):5'- CCTCAGGAATGCTATACATGAACATG -3'
(R):5'- TCTGTCAGTTAAAACCAGTACATAAC -3'
Posted On2018-07-24