Incidental Mutation 'R6701:Bfsp2'
ID528756
Institutional Source Beutler Lab
Gene Symbol Bfsp2
Ensembl Gene ENSMUSG00000032556
Gene Namebeaded filament structural protein 2, phakinin
SynonymsCP49
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R6701 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location103424924-103480420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103479878 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 117 (V117M)
Ref Sequence ENSEMBL: ENSMUSP00000116249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049452] [ENSMUST00000124310] [ENSMUST00000189066] [ENSMUST00000189588]
Predicted Effect probably benign
Transcript: ENSMUST00000049452
SMART Domains Protein: ENSMUSP00000046021
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TMEM108 61 574 1.6e-275 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124310
AA Change: V117M

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116249
Gene: ENSMUSG00000032556
AA Change: V117M

DomainStartEndE-ValueType
Filament 102 416 6.85e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144420
Predicted Effect probably benign
Transcript: ENSMUST00000189066
SMART Domains Protein: ENSMUSP00000141160
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189588
SMART Domains Protein: ENSMUSP00000140027
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191069
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] More than 99% of the vertebrate ocular lens is comprised of terminally differentiated lens fiber cells. Two lens-specific intermediate filament-like proteins, the protein product of this gene (phakinin), and filensin, are expressed only after fiber cell differentiation has begun. Both proteins are found in a structurally unique cytoskeletal element that is referred to as the beaded filament (BF). Mutations in this gene have been associated with juvenile-onset, progressive cataracts and Dowling-Meara epidermolysis bullosa simplex. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mutations at this locus result in eye abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Arid4a A T 12: 71,087,512 K1196I probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Ddx21 T C 10: 62,590,691 Y461C probably damaging Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eml6 T A 11: 29,785,748 L1139F probably damaging Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Guf1 T A 5: 69,558,253 D47E probably damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Hsd17b1 C A 11: 101,080,155 C312* probably null Het
Ighg2b T C 12: 113,307,079 T144A unknown Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1009 A G 2: 85,722,331 K309E probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc35f5 T C 1: 125,562,610 V103A probably damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r67 G A 7: 85,152,815 P93S probably damaging Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Zfp990 A G 4: 145,538,178 D582G probably benign Het
Other mutations in Bfsp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Bfsp2 APN 9 103453098 missense possibly damaging 0.90
IGL01160:Bfsp2 APN 9 103480168 missense probably benign 0.02
R0408:Bfsp2 UTSW 9 103480100 missense probably benign 0.06
R0463:Bfsp2 UTSW 9 103426655 missense possibly damaging 0.94
R1454:Bfsp2 UTSW 9 103480225 start codon destroyed probably null 0.59
R1854:Bfsp2 UTSW 9 103449831 missense probably benign 0.01
R2139:Bfsp2 UTSW 9 103449875 missense probably benign 0.19
R2187:Bfsp2 UTSW 9 103426777 nonsense probably null
R3975:Bfsp2 UTSW 9 103480072 missense probably benign 0.00
R4823:Bfsp2 UTSW 9 103479883 missense probably damaging 1.00
R5035:Bfsp2 UTSW 9 103479866 missense probably benign 0.35
R5973:Bfsp2 UTSW 9 103432657 critical splice donor site probably null
R6005:Bfsp2 UTSW 9 103448550 missense probably damaging 0.99
R6106:Bfsp2 UTSW 9 103479824 missense probably benign 0.09
R6348:Bfsp2 UTSW 9 103480072 missense probably benign 0.17
R6364:Bfsp2 UTSW 9 103448628 missense probably damaging 0.98
R6736:Bfsp2 UTSW 9 103480204 missense possibly damaging 0.60
R7129:Bfsp2 UTSW 9 103479919 missense probably damaging 0.99
R7204:Bfsp2 UTSW 9 103432666 missense probably damaging 0.99
R7329:Bfsp2 UTSW 9 103449922 missense probably benign 0.01
R7453:Bfsp2 UTSW 9 103453107 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGATCTACTTCCCTGGCCTC -3'
(R):5'- TATGTAGGAGTCGCACCCAG -3'

Sequencing Primer
(F):5'- TCTCAGACCTCTAGCAAGCCTCTAG -3'
(R):5'- ACCCAGTGGTGGCATAGGTG -3'
Posted On2018-07-24