Incidental Mutation 'R6701:Ddx21'
ID528758
Institutional Source Beutler Lab
Gene Symbol Ddx21
Ensembl Gene ENSMUSG00000020075
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 21
SynonymsD10Wsu42e, RH II/Gu, D10Ertd645e, RH-II/Gualpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6701 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location62580251-62602281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62590691 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 461 (Y461C)
Ref Sequence ENSEMBL: ENSMUSP00000042691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045866]
PDB Structure Gu_alpha_helicase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000045866
AA Change: Y461C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042691
Gene: ENSMUSG00000020075
AA Change: Y461C

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 107 139 N/A INTRINSIC
internal_repeat_1 140 160 2.96e-8 PROSPERO
low complexity region 162 171 N/A INTRINSIC
low complexity region 199 208 N/A INTRINSIC
internal_repeat_1 214 234 2.96e-8 PROSPERO
DEXDc 277 484 2.76e-56 SMART
HELICc 524 604 1.55e-27 SMART
low complexity region 682 688 N/A INTRINSIC
Pfam:GUCT 692 787 1.6e-33 PFAM
low complexity region 827 843 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220060
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an antigen recognized by autoimmune antibodies from a patient with watermelon stomach disease. This protein unwinds double-stranded RNA, folds single-stranded RNA, and may play important roles in ribosomal RNA biogenesis, RNA editing, RNA transport, and general transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Arid4a A T 12: 71,087,512 K1196I probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Bfsp2 C T 9: 103,479,878 V117M possibly damaging Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eml6 T A 11: 29,785,748 L1139F probably damaging Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Guf1 T A 5: 69,558,253 D47E probably damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Hsd17b1 C A 11: 101,080,155 C312* probably null Het
Ighg2b T C 12: 113,307,079 T144A unknown Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1009 A G 2: 85,722,331 K309E probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc35f5 T C 1: 125,562,610 V103A probably damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r67 G A 7: 85,152,815 P93S probably damaging Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Zfp990 A G 4: 145,538,178 D582G probably benign Het
Other mutations in Ddx21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Ddx21 APN 10 62598402 nonsense probably null
IGL01144:Ddx21 APN 10 62598550 missense unknown
IGL01655:Ddx21 APN 10 62587491 missense probably damaging 0.98
IGL01694:Ddx21 APN 10 62598651 nonsense probably null
IGL01752:Ddx21 APN 10 62587507 missense probably damaging 1.00
IGL02827:Ddx21 APN 10 62598374 missense probably benign 0.04
IGL03140:Ddx21 APN 10 62594071 missense probably damaging 1.00
IGL03248:Ddx21 APN 10 62591990 missense possibly damaging 0.87
R0131:Ddx21 UTSW 10 62584752 missense possibly damaging 0.96
R0555:Ddx21 UTSW 10 62587528 missense probably damaging 1.00
R1437:Ddx21 UTSW 10 62598590 missense unknown
R1780:Ddx21 UTSW 10 62594147 splice site probably benign
R1875:Ddx21 UTSW 10 62594068 missense probably damaging 1.00
R2696:Ddx21 UTSW 10 62594092 missense possibly damaging 0.93
R4639:Ddx21 UTSW 10 62591837 nonsense probably null
R4678:Ddx21 UTSW 10 62594003 missense probably benign 0.06
R4767:Ddx21 UTSW 10 62591972 missense probably damaging 1.00
R4799:Ddx21 UTSW 10 62588121 missense probably damaging 0.98
R5145:Ddx21 UTSW 10 62587539 critical splice acceptor site probably null
R5243:Ddx21 UTSW 10 62602213 start codon destroyed probably null 0.02
R6085:Ddx21 UTSW 10 62594087 missense probably damaging 1.00
R7134:Ddx21 UTSW 10 62591855 missense possibly damaging 0.95
R7517:Ddx21 UTSW 10 62588790 missense probably damaging 0.98
R7555:Ddx21 UTSW 10 62598243 missense probably benign 0.03
R7577:Ddx21 UTSW 10 62590670 missense probably benign 0.19
R7704:Ddx21 UTSW 10 62594086 missense probably damaging 1.00
Z1177:Ddx21 UTSW 10 62587538 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTGCAATCCAGAAAGCAC -3'
(R):5'- GCCAGTGGTCCGTGTTAATG -3'

Sequencing Primer
(F):5'- AATTGGCTCTGCATAGGGAC -3'
(R):5'- CCGTGTTAATGGTGCTGCG -3'
Posted On2018-07-24