Incidental Mutation 'R6701:Arid4a'
ID528766
Institutional Source Beutler Lab
Gene Symbol Arid4a
Ensembl Gene ENSMUSG00000048118
Gene NameAT rich interactive domain 4A (RBP1-like)
SynonymsRbbp1, A630067N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6701 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location71015990-71098592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71087512 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 1196 (K1196I)
Ref Sequence ENSEMBL: ENSMUSP00000035512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046305]
Predicted Effect probably damaging
Transcript: ENSMUST00000046305
AA Change: K1196I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: K1196I

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 3.6e-12 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 170 262 4e-32 PFAM
ARID 306 397 6.7e-37 SMART
BRIGHT 310 402 2.3e-40 SMART
low complexity region 411 422 N/A INTRINSIC
CHROMO 483 652 6.8e-6 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
coiled coil region 1185 1224 N/A INTRINSIC
low complexity region 1229 1252 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Bfsp2 C T 9: 103,479,878 V117M possibly damaging Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Ddx21 T C 10: 62,590,691 Y461C probably damaging Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eml6 T A 11: 29,785,748 L1139F probably damaging Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Guf1 T A 5: 69,558,253 D47E probably damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Hsd17b1 C A 11: 101,080,155 C312* probably null Het
Ighg2b T C 12: 113,307,079 T144A unknown Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1009 A G 2: 85,722,331 K309E probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc35f5 T C 1: 125,562,610 V103A probably damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r67 G A 7: 85,152,815 P93S probably damaging Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Zfp990 A G 4: 145,538,178 D582G probably benign Het
Other mutations in Arid4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Arid4a APN 12 71072593 missense probably damaging 1.00
IGL00546:Arid4a APN 12 71075671 missense probably benign
IGL00553:Arid4a APN 12 71075977 missense probably benign 0.04
IGL00708:Arid4a APN 12 71072728 missense probably benign 0.02
IGL00847:Arid4a APN 12 71075718 missense probably damaging 1.00
IGL01112:Arid4a APN 12 71072733 critical splice donor site probably null
IGL01456:Arid4a APN 12 71067262 missense probably benign 0.00
IGL01505:Arid4a APN 12 71037115 missense probably damaging 1.00
IGL01555:Arid4a APN 12 71061527 splice site probably benign
IGL01631:Arid4a APN 12 71022262 splice site probably benign
IGL02958:Arid4a APN 12 71097563 missense probably benign 0.01
IGL03087:Arid4a APN 12 71075245 missense possibly damaging 0.94
IGL03111:Arid4a APN 12 71039966 missense probably damaging 1.00
IGL03234:Arid4a APN 12 71045060 missense probably benign 0.34
After_8 UTSW 12 71023498 critical splice acceptor site probably null
ariano UTSW 12 71069860 nonsense probably null
guava UTSW 12 71072632 missense probably damaging 0.99
limoncello UTSW 12 71067341 splice site probably null
Sahara UTSW 12 71060115 nonsense probably null
Under_8 UTSW 12 71063206 missense probably benign 0.10
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0270:Arid4a UTSW 12 71072632 missense probably damaging 0.99
R0310:Arid4a UTSW 12 71075830 missense probably benign 0.05
R0504:Arid4a UTSW 12 71047214 missense probably damaging 1.00
R1061:Arid4a UTSW 12 71074955 missense probably damaging 1.00
R1087:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1169:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1171:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1531:Arid4a UTSW 12 71076005 missense probably benign 0.01
R1674:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1676:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1768:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1833:Arid4a UTSW 12 71075466 missense possibly damaging 0.50
R1878:Arid4a UTSW 12 71087589 missense probably damaging 1.00
R2290:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2292:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R3411:Arid4a UTSW 12 71061525 splice site probably benign
R3768:Arid4a UTSW 12 71067119 missense probably damaging 1.00
R3838:Arid4a UTSW 12 71075785 missense possibly damaging 0.94
R4320:Arid4a UTSW 12 71069995 missense possibly damaging 0.69
R4589:Arid4a UTSW 12 71069964 missense probably damaging 1.00
R4829:Arid4a UTSW 12 71023498 critical splice acceptor site probably null
R4862:Arid4a UTSW 12 71075947 missense probably damaging 0.96
R4952:Arid4a UTSW 12 71023525 missense possibly damaging 0.64
R5072:Arid4a UTSW 12 71045079 missense probably benign 0.08
R5423:Arid4a UTSW 12 71069860 nonsense probably null
R5767:Arid4a UTSW 12 71060093 missense probably damaging 1.00
R5911:Arid4a UTSW 12 71069973 missense probably damaging 1.00
R5952:Arid4a UTSW 12 71063206 missense probably benign 0.10
R6088:Arid4a UTSW 12 71022236 missense probably damaging 0.99
R6235:Arid4a UTSW 12 71069772 splice site probably null
R6277:Arid4a UTSW 12 71039891 missense possibly damaging 0.49
R6455:Arid4a UTSW 12 71075088 missense probably benign 0.04
R6523:Arid4a UTSW 12 71067341 splice site probably null
R6812:Arid4a UTSW 12 71047263 missense possibly damaging 0.92
R6815:Arid4a UTSW 12 71017082 splice site probably null
R6837:Arid4a UTSW 12 71075515 missense probably benign
R6858:Arid4a UTSW 12 71023509 missense probably benign 0.01
R6895:Arid4a UTSW 12 71063302 missense probably benign 0.18
R6901:Arid4a UTSW 12 71067137 missense probably damaging 0.99
R6905:Arid4a UTSW 12 71061544 missense probably benign 0.43
R7387:Arid4a UTSW 12 71087496 missense probably damaging 1.00
R7570:Arid4a UTSW 12 71063142 nonsense probably null
R7772:Arid4a UTSW 12 71061589 missense possibly damaging 0.65
R8194:Arid4a UTSW 12 71060115 nonsense probably null
R8206:Arid4a UTSW 12 71086587 missense probably damaging 1.00
Z1176:Arid4a UTSW 12 71039920 missense possibly damaging 0.89
Z1177:Arid4a UTSW 12 71075637 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CGCATCTCGTGTAAAGAGCTTATG -3'
(R):5'- CTGAAGGCAGAGAGTGTATCTG -3'

Sequencing Primer
(F):5'- ATCTCGTGTAAAGAGCTTATGCAGGG -3'
(R):5'- TCTGAAGGCAGAGAGAGTATCTG -3'
Posted On2018-07-24