Mutagenetix > Incidental Mutation

Incidental Mutation 'R6701:Arid4a'

528766

Institutional Source

Beutler Lab

Gene Symbol

Arid4a

Ensembl Gene

ENSMUSG00000048118

Gene Name

AT rich interactive domain 4A (RBP1-like)

Synonyms

Rbbp1, A630067N03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6701 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71015990-71098592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 71087512 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Isoleucine at position 1196 (K1196I)

Ref Sequence

ENSEMBL: ENSMUSP00000035512 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046305]

AlphaFold

F8VPQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000046305
AA Change: K1196I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: K1196I

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
TUDOR	58	114	3.6e-12	SMART
low complexity region	152	167	N/A	INTRINSIC
Pfam:RBB1NT	170	262	4e-32	PFAM
ARID	306	397	6.7e-37	SMART
BRIGHT	310	402	2.3e-40	SMART
low complexity region	411	422	N/A	INTRINSIC
CHROMO	483	652	6.8e-6	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	965	976	N/A	INTRINSIC
low complexity region	991	1003	N/A	INTRINSIC
coiled coil region	1185	1224	N/A	INTRINSIC
low complexity region	1229	1252	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap12	A	T	10: 4,355,243	K684N	probably damaging	Het
Akna	C	T	4: 63,395,280	G202D	probably benign	Het
Alpk1	T	A	3: 127,729,336	D19V	probably damaging	Het
Asic3	A	T	5: 24,414,129	M140L	possibly damaging	Het
BC055324	T	C	1: 163,971,843		probably null	Het
Bfsp2	C	T	9: 103,479,878	V117M	possibly damaging	Het
Cd244	C	A	1: 171,574,155	L150M	possibly damaging	Het
Cd3e	T	C	9: 45,001,053	Y131C	probably damaging	Het
Clptm1l	T	C	13: 73,608,906	I202T	probably benign	Het
Cnot4	G	T	6: 35,068,604	T224K	probably damaging	Het
Col24a1	A	G	3: 145,314,380	T171A	probably benign	Het
Col6a3	C	T	1: 90,792,462	R1552Q	probably benign	Het
Dcc	T	A	18: 71,809,120	T309S	probably benign	Het
Ddx21	T	C	10: 62,590,691	Y461C	probably damaging	Het
Dnah10	G	A	5: 124,760,159	V989M	probably benign	Het
Dppa4	A	T	16: 48,291,311	K220*	probably null	Het
Dysf	G	A	6: 84,112,190	G912S	probably damaging	Het
Efhb	A	T	17: 53,399,063	N815K	probably benign	Het
Eml6	T	A	11: 29,785,748	L1139F	probably damaging	Het
Eprs	T	G	1: 185,370,890	I78S	probably damaging	Het
Fat1	C	A	8: 44,950,681	S156R	probably damaging	Het
Frzb	G	A	2: 80,446,819	R8W	possibly damaging	Het
Guf1	T	A	5: 69,558,253	D47E	probably damaging	Het
Haus3	A	T	5: 34,167,734	F194I	probably damaging	Het
Hivep3	C	T	4: 120,094,540	R18W	probably damaging	Het
Hnf1b	A	G	11: 83,889,094	T392A	probably damaging	Het
Hsd17b1	C	A	11: 101,080,155	C312*	probably null	Het
Ighg2b	T	C	12: 113,307,079	T144A	unknown	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Jhy	T	C	9: 40,917,591	R340G	probably damaging	Het
Klra3	C	G	6: 130,330,253	V144L	probably benign	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Lrmp	G	T	6: 145,144,976	E61*	probably null	Het
Lrrc4	A	G	6: 28,830,906	F237L	possibly damaging	Het
Lyst	T	A	13: 13,681,485	C2464S	probably benign	Het
Maml1	T	C	11: 50,266,682	E222G	probably damaging	Het
Med15	C	T	16: 17,671,583		probably benign	Het
Naalad2	T	C	9: 18,385,148	I69V	probably null	Het
Neb	T	C	2: 52,291,208	K1129R	probably damaging	Het
Nsun6	A	T	2: 15,036,302	N159K	probably benign	Het
Nup153	A	T	13: 46,687,065	N1022K	probably benign	Het
Olfr1009	A	G	2: 85,722,331	K309E	probably benign	Het
Olfr1138	C	T	2: 87,737,409	R305K	probably benign	Het
Olfr389	T	C	11: 73,776,470	N286D	probably damaging	Het
Otof	T	A	5: 30,370,797	K1901*	probably null	Het
Pde1c	A	T	6: 56,181,700	Y136N	probably damaging	Het
Phc1	G	T	6: 122,325,774	N263K	probably damaging	Het
Plxna1	A	T	6: 89,319,448	D1871E	probably damaging	Het
Prdm6	T	A	18: 53,536,679	M123K	possibly damaging	Het
Ranbp17	T	C	11: 33,475,066	D430G	probably damaging	Het
Rsl24d1	C	A	9: 73,114,997	T287K	probably damaging	Het
Scn1a	G	A	2: 66,337,960	R101W	probably damaging	Het
Scn8a	A	G	15: 101,040,096	D1741G	probably damaging	Het
Serpinb1c	T	C	13: 32,896,941	Q53R	probably benign	Het
Serpinf2	C	T	11: 75,432,443	R479H	probably damaging	Het
Sis	T	A	3: 72,949,527	D448V	probably damaging	Het
Slc27a6	T	A	18: 58,579,875	D256E	probably benign	Het
Slc30a8	A	G	15: 52,331,574	Y243C	possibly damaging	Het
Slc35f5	T	C	1: 125,562,610	V103A	probably damaging	Het
Slc44a2	T	C	9: 21,320,853		probably null	Het
Slc7a9	T	C	7: 35,459,849	L327P	probably damaging	Het
Stat4	A	G	1: 52,102,974	Y660C	probably damaging	Het
Terb1	T	C	8: 104,472,756	T519A	possibly damaging	Het
Tonsl	A	T	15: 76,629,300	S1245T	probably damaging	Het
Ttn	A	T	2: 76,788,818	S16072R	probably damaging	Het
Ttn	A	T	2: 76,909,246	Y3650N	probably benign	Het
Uhrf1bp1	T	A	17: 27,887,357	C952*	probably null	Het
Uso1	T	C	5: 92,166,585	F117S	probably damaging	Het
Vmn1r211	T	C	13: 22,851,609	H296R	probably benign	Het
Vmn2r67	G	A	7: 85,152,815	P93S	probably damaging	Het
Xirp2	A	T	2: 67,516,225	I2937F	possibly damaging	Het
Zc2hc1c	C	A	12: 85,289,672		probably null	Het
Zfp12	T	C	5: 143,244,464	V182A	probably benign	Het
Zfp473	G	T	7: 44,732,794	A705D	possibly damaging	Het
Zfp937	G	T	2: 150,239,216	G389C	probably damaging	Het
Zfp990	A	G	4: 145,538,178	D582G	probably benign	Het

Other mutations in Arid4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Arid4a	APN	12	71072593	missense	probably damaging	1.00
IGL00546:Arid4a	APN	12	71075671	missense	probably benign
IGL00553:Arid4a	APN	12	71075977	missense	probably benign	0.04
IGL00708:Arid4a	APN	12	71072728	missense	probably benign	0.02
IGL00847:Arid4a	APN	12	71075718	missense	probably damaging	1.00
IGL01112:Arid4a	APN	12	71072733	critical splice donor site	probably null
IGL01456:Arid4a	APN	12	71067262	missense	probably benign	0.00
IGL01505:Arid4a	APN	12	71037115	missense	probably damaging	1.00
IGL01555:Arid4a	APN	12	71061527	splice site	probably benign
IGL01631:Arid4a	APN	12	71022262	splice site	probably benign
IGL02958:Arid4a	APN	12	71097563	missense	probably benign	0.01
IGL03087:Arid4a	APN	12	71075245	missense	possibly damaging	0.94
IGL03111:Arid4a	APN	12	71039966	missense	probably damaging	1.00
IGL03234:Arid4a	APN	12	71045060	missense	probably benign	0.34
After_8	UTSW	12	71023498	critical splice acceptor site	probably null
ariano	UTSW	12	71069860	nonsense	probably null
Dusty	UTSW	12	71060093	missense	probably damaging	1.00
guava	UTSW	12	71072632	missense	probably damaging	0.99
limoncello	UTSW	12	71067341	splice site	probably null
Sahara	UTSW	12	71060115	nonsense	probably null
Under_8	UTSW	12	71063206	missense	probably benign	0.10
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0270:Arid4a	UTSW	12	71072632	missense	probably damaging	0.99
R0310:Arid4a	UTSW	12	71075830	missense	probably benign	0.05
R0504:Arid4a	UTSW	12	71047214	missense	probably damaging	1.00
R1061:Arid4a	UTSW	12	71074955	missense	probably damaging	1.00
R1087:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1169:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1171:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1531:Arid4a	UTSW	12	71076005	missense	probably benign	0.01
R1674:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1676:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1768:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1833:Arid4a	UTSW	12	71075466	missense	possibly damaging	0.50
R1878:Arid4a	UTSW	12	71087589	missense	probably damaging	1.00
R2290:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2292:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R3411:Arid4a	UTSW	12	71061525	splice site	probably benign
R3768:Arid4a	UTSW	12	71067119	missense	probably damaging	1.00
R3838:Arid4a	UTSW	12	71075785	missense	possibly damaging	0.94
R4320:Arid4a	UTSW	12	71069995	missense	possibly damaging	0.69
R4589:Arid4a	UTSW	12	71069964	missense	probably damaging	1.00
R4829:Arid4a	UTSW	12	71023498	critical splice acceptor site	probably null
R4862:Arid4a	UTSW	12	71075947	missense	probably damaging	0.96
R4952:Arid4a	UTSW	12	71023525	missense	possibly damaging	0.64
R5072:Arid4a	UTSW	12	71045079	missense	probably benign	0.08
R5423:Arid4a	UTSW	12	71069860	nonsense	probably null
R5767:Arid4a	UTSW	12	71060093	missense	probably damaging	1.00
R5911:Arid4a	UTSW	12	71069973	missense	probably damaging	1.00
R5952:Arid4a	UTSW	12	71063206	missense	probably benign	0.10
R6088:Arid4a	UTSW	12	71022236	missense	probably damaging	0.99
R6235:Arid4a	UTSW	12	71069772	splice site	probably null
R6277:Arid4a	UTSW	12	71039891	missense	possibly damaging	0.49
R6455:Arid4a	UTSW	12	71075088	missense	probably benign	0.04
R6523:Arid4a	UTSW	12	71067341	splice site	probably null
R6812:Arid4a	UTSW	12	71047263	missense	possibly damaging	0.92
R6815:Arid4a	UTSW	12	71017082	splice site	probably null
R6837:Arid4a	UTSW	12	71075515	missense	probably benign
R6858:Arid4a	UTSW	12	71023509	missense	probably benign	0.01
R6895:Arid4a	UTSW	12	71063302	missense	probably benign	0.18
R6901:Arid4a	UTSW	12	71067137	missense	probably damaging	0.99
R6905:Arid4a	UTSW	12	71061544	missense	probably benign	0.43
R7387:Arid4a	UTSW	12	71087496	missense	probably damaging	1.00
R7570:Arid4a	UTSW	12	71063142	nonsense	probably null
R7772:Arid4a	UTSW	12	71061589	missense	possibly damaging	0.65
R8194:Arid4a	UTSW	12	71060115	nonsense	probably null
R8206:Arid4a	UTSW	12	71086587	missense	probably damaging	1.00
R8552:Arid4a	UTSW	12	71060075	missense	probably benign
R8696:Arid4a	UTSW	12	71063316	missense	probably damaging	1.00
R9015:Arid4a	UTSW	12	71075394	missense	possibly damaging	0.89
R9109:Arid4a	UTSW	12	71075355	missense	probably damaging	1.00
R9450:Arid4a	UTSW	12	71072600	missense
Z1176:Arid4a	UTSW	12	71039920	missense	possibly damaging	0.89
Z1177:Arid4a	UTSW	12	71075637	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CGCATCTCGTGTAAAGAGCTTATG -3'
(R):5'- CTGAAGGCAGAGAGTGTATCTG -3'

Sequencing Primer
(F):5'- ATCTCGTGTAAAGAGCTTATGCAGGG -3'
(R):5'- TCTGAAGGCAGAGAGAGTATCTG -3'

Posted On

2018-07-24