Incidental Mutation 'R6701:Ighg2b'
ID528768
Institutional Source Beutler Lab
Gene Symbol Ighg2b
Ensembl Gene ENSMUSG00000076613
Gene Nameimmunoglobulin heavy constant gamma 2B
SynonymsIgG2b, gamma2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6701 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location113302965-113307933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113307079 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 144 (T144A)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000103418
AA Change: T144A
SMART Domains Protein: ENSMUSP00000100214
Gene: ENSMUSG00000076613
AA Change: T144A

DomainStartEndE-ValueType
IGc1 22 92 6.9e-16 SMART
low complexity region 108 121 N/A INTRINSIC
IG_like 145 220 4.02e-2 SMART
IGc1 251 324 1.64e-31 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192188
AA Change: T144A
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Arid4a A T 12: 71,087,512 K1196I probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Bfsp2 C T 9: 103,479,878 V117M possibly damaging Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Ddx21 T C 10: 62,590,691 Y461C probably damaging Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eml6 T A 11: 29,785,748 L1139F probably damaging Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Guf1 T A 5: 69,558,253 D47E probably damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Hsd17b1 C A 11: 101,080,155 C312* probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1009 A G 2: 85,722,331 K309E probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc35f5 T C 1: 125,562,610 V103A probably damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r67 G A 7: 85,152,815 P93S probably damaging Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Zfp990 A G 4: 145,538,178 D582G probably benign Het
Other mutations in Ighg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Ighg2b APN 12 113307036 missense possibly damaging 0.79
IGL01837:Ighg2b APN 12 113306445 missense unknown
IGL01973:Ighg2b APN 12 113307685 missense unknown
IGL01998:Ighg2b APN 12 113307089 missense unknown
IGL02147:Ighg2b APN 12 113306391 makesense probably null
IGL02183:Ighg2b APN 12 113307829 missense unknown
IGL03089:Ighg2b APN 12 113306678 missense probably damaging 1.00
PIT4453001:Ighg2b UTSW 12 113306872 missense unknown
R4199:Ighg2b UTSW 12 113307287 missense probably damaging 0.96
R4459:Ighg2b UTSW 12 113306958 missense unknown
R4577:Ighg2b UTSW 12 113306892 missense unknown
R4589:Ighg2b UTSW 12 113306484 missense unknown
R4807:Ighg2b UTSW 12 113304345 unclassified probably benign
R4822:Ighg2b UTSW 12 113306391 makesense probably null
R5424:Ighg2b UTSW 12 113307930 missense unknown
R5641:Ighg2b UTSW 12 113307147 missense unknown
R6297:Ighg2b UTSW 12 113306892 missense unknown
R6703:Ighg2b UTSW 12 113305033 unclassified probably benign
R6880:Ighg2b UTSW 12 113307106 missense
R7342:Ighg2b UTSW 12 113306430 missense
R7505:Ighg2b UTSW 12 113304980 missense
R7908:Ighg2b UTSW 12 113306454 missense
R7989:Ighg2b UTSW 12 113306454 missense
Predicted Primers PCR Primer
(F):5'- GCATTTGAACTCCTTGCCAC -3'
(R):5'- AAGGAGTGTCACAAATGCCCAG -3'

Sequencing Primer
(F):5'- GAACTCCTTGCCACTCATCCAG -3'
(R):5'- GTGTCACAAATGCCCAGGTAAGTC -3'
Posted On2018-07-24