Mutagenetix > Incidental Mutations

Incidental Mutation 'R6701:Tonsl'

528775

Institutional Source

Beutler Lab

Gene Symbol

Tonsl

Ensembl Gene

ENSMUSG00000059323

Gene Name

tonsoku-like, DNA repair protein

Synonyms

Nfkbil2, 2810439M11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6701 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76626002-76639958 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76629300 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1245 (S1245T)

Ref Sequence

ENSEMBL: ENSMUSP00000129597 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078803] [ENSMUST00000165190] [ENSMUST00000168185] [ENSMUST00000229019]

Predicted Effect

probably benign
Transcript: ENSMUST00000078803

SMART Domains

Protein: ENSMUSP00000077856
Gene: ENSMUSG00000115987

Domain	Start	End	E-Value	Type
Pfam:VPS28	39	219	2.2e-70	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163990

Predicted Effect

probably benign
Transcript: ENSMUST00000165163

SMART Domains

Protein: ENSMUSP00000131229
Gene: ENSMUSG00000059323

Domain	Start	End	E-Value	Type
low complexity region	33	51	N/A	INTRINSIC
low complexity region	52	62	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165190

SMART Domains

Protein: ENSMUSP00000131368
Gene: ENSMUSG00000059323

Domain	Start	End	E-Value	Type
TPR	27	60	5.33e1	SMART
Blast:TPR	67	100	4e-9	BLAST
TPR	162	195	1.77e1	SMART
TPR	202	235	1.36e1	SMART
low complexity region	259	271	N/A	INTRINSIC
TPR	311	344	1.4e1	SMART
TPR	352	385	7.27e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168185
AA Change: S1245T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129597
Gene: ENSMUSG00000059323
AA Change: S1245T

Domain	Start	End	E-Value	Type
TPR	27	60	5.33e1	SMART
Blast:TPR	67	100	7e-9	BLAST
TPR	162	195	1.77e1	SMART
TPR	202	235	1.36e1	SMART
Pfam:TPR_8	242	274	8.7e-3	PFAM
TPR	311	344	1.4e1	SMART
TPR	352	385	7.27e0	SMART
low complexity region	413	437	N/A	INTRINSIC
low complexity region	465	494	N/A	INTRINSIC
low complexity region	500	511	N/A	INTRINSIC
ANK	528	559	8.36e1	SMART
ANK	561	590	4.85e-8	SMART
ANK	597	626	2.85e-5	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	729	753	N/A	INTRINSIC
low complexity region	1031	1044	N/A	INTRINSIC
LRR	1058	1085	2.86e-1	SMART
LRR	1086	1113	5.88e-1	SMART
LRR	1117	1144	1.67e-2	SMART
LRR	1177	1204	2.72e0	SMART
LRR	1236	1263	7.02e0	SMART
LRR	1264	1292	1.46e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171478

Predicted Effect

probably benign
Transcript: ENSMUST00000229019

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229052

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229261

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229545

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap12	A	T	10: 4,355,243	K684N	probably damaging	Het
Akna	C	T	4: 63,395,280	G202D	probably benign	Het
Alpk1	T	A	3: 127,729,336	D19V	probably damaging	Het
Arid4a	A	T	12: 71,087,512	K1196I	probably damaging	Het
Asic3	A	T	5: 24,414,129	M140L	possibly damaging	Het
BC055324	T	C	1: 163,971,843		probably null	Het
Bfsp2	C	T	9: 103,479,878	V117M	possibly damaging	Het
Cd244	C	A	1: 171,574,155	L150M	possibly damaging	Het
Cd3e	T	C	9: 45,001,053	Y131C	probably damaging	Het
Clptm1l	T	C	13: 73,608,906	I202T	probably benign	Het
Cnot4	G	T	6: 35,068,604	T224K	probably damaging	Het
Col24a1	A	G	3: 145,314,380	T171A	probably benign	Het
Col6a3	C	T	1: 90,792,462	R1552Q	probably benign	Het
Dcc	T	A	18: 71,809,120	T309S	probably benign	Het
Ddx21	T	C	10: 62,590,691	Y461C	probably damaging	Het
Dnah10	G	A	5: 124,760,159	V989M	probably benign	Het
Dppa4	A	T	16: 48,291,311	K220*	probably null	Het
Dysf	G	A	6: 84,112,190	G912S	probably damaging	Het
Efhb	A	T	17: 53,399,063	N815K	probably benign	Het
Eml6	T	A	11: 29,785,748	L1139F	probably damaging	Het
Eprs	T	G	1: 185,370,890	I78S	probably damaging	Het
Fat1	C	A	8: 44,950,681	S156R	probably damaging	Het
Frzb	G	A	2: 80,446,819	R8W	possibly damaging	Het
Guf1	T	A	5: 69,558,253	D47E	probably damaging	Het
Haus3	A	T	5: 34,167,734	F194I	probably damaging	Het
Hivep3	C	T	4: 120,094,540	R18W	probably damaging	Het
Hnf1b	A	G	11: 83,889,094	T392A	probably damaging	Het
Hsd17b1	C	A	11: 101,080,155	C312*	probably null	Het
Ighg2b	T	C	12: 113,307,079	T144A	unknown	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Jhy	T	C	9: 40,917,591	R340G	probably damaging	Het
Klra3	C	G	6: 130,330,253	V144L	probably benign	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Lrmp	G	T	6: 145,144,976	E61*	probably null	Het
Lrrc4	A	G	6: 28,830,906	F237L	possibly damaging	Het
Lyst	T	A	13: 13,681,485	C2464S	probably benign	Het
Maml1	T	C	11: 50,266,682	E222G	probably damaging	Het
Med15	C	T	16: 17,671,583		probably benign	Het
Naalad2	T	C	9: 18,385,148	I69V	probably null	Het
Neb	T	C	2: 52,291,208	K1129R	probably damaging	Het
Nsun6	A	T	2: 15,036,302	N159K	probably benign	Het
Nup153	A	T	13: 46,687,065	N1022K	probably benign	Het
Olfr1009	A	G	2: 85,722,331	K309E	probably benign	Het
Olfr1138	C	T	2: 87,737,409	R305K	probably benign	Het
Olfr389	T	C	11: 73,776,470	N286D	probably damaging	Het
Otof	T	A	5: 30,370,797	K1901*	probably null	Het
Pde1c	A	T	6: 56,181,700	Y136N	probably damaging	Het
Phc1	G	T	6: 122,325,774	N263K	probably damaging	Het
Plxna1	A	T	6: 89,319,448	D1871E	probably damaging	Het
Prdm6	T	A	18: 53,536,679	M123K	possibly damaging	Het
Ranbp17	T	C	11: 33,475,066	D430G	probably damaging	Het
Rsl24d1	C	A	9: 73,114,997	T287K	probably damaging	Het
Scn1a	G	A	2: 66,337,960	R101W	probably damaging	Het
Scn8a	A	G	15: 101,040,096	D1741G	probably damaging	Het
Serpinb1c	T	C	13: 32,896,941	Q53R	probably benign	Het
Serpinf2	C	T	11: 75,432,443	R479H	probably damaging	Het
Sis	T	A	3: 72,949,527	D448V	probably damaging	Het
Slc27a6	T	A	18: 58,579,875	D256E	probably benign	Het
Slc30a8	A	G	15: 52,331,574	Y243C	possibly damaging	Het
Slc35f5	T	C	1: 125,562,610	V103A	probably damaging	Het
Slc44a2	T	C	9: 21,320,853		probably null	Het
Slc7a9	T	C	7: 35,459,849	L327P	probably damaging	Het
Stat4	A	G	1: 52,102,974	Y660C	probably damaging	Het
Terb1	T	C	8: 104,472,756	T519A	possibly damaging	Het
Ttn	A	T	2: 76,788,818	S16072R	probably damaging	Het
Ttn	A	T	2: 76,909,246	Y3650N	probably benign	Het
Uhrf1bp1	T	A	17: 27,887,357	C952*	probably null	Het
Uso1	T	C	5: 92,166,585	F117S	probably damaging	Het
Vmn1r211	T	C	13: 22,851,609	H296R	probably benign	Het
Vmn2r67	G	A	7: 85,152,815	P93S	probably damaging	Het
Xirp2	A	T	2: 67,516,225	I2937F	possibly damaging	Het
Zc2hc1c	C	A	12: 85,289,672		probably null	Het
Zfp12	T	C	5: 143,244,464	V182A	probably benign	Het
Zfp473	G	T	7: 44,732,794	A705D	possibly damaging	Het
Zfp937	G	T	2: 150,239,216	G389C	probably damaging	Het
Zfp990	A	G	4: 145,538,178	D582G	probably benign	Het

Other mutations in Tonsl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Tonsl	APN	15	76638496	missense	possibly damaging	0.78
IGL00763:Tonsl	APN	15	76633868	missense	probably damaging	1.00
IGL00796:Tonsl	APN	15	76625149	missense	probably benign
IGL00965:Tonsl	APN	15	76631880	splice site	probably benign
IGL01434:Tonsl	APN	15	76631102	missense	probably benign	0.11
IGL01859:Tonsl	APN	15	76634780	missense	probably damaging	0.97
IGL02112:Tonsl	APN	15	76633402	missense	probably benign	0.01
IGL02189:Tonsl	APN	15	76623178	missense	possibly damaging	0.56
IGL02281:Tonsl	APN	15	76634074	missense	probably damaging	1.00
IGL02627:Tonsl	APN	15	76634095	missense	probably damaging	0.99
IGL02750:Tonsl	APN	15	76633389	missense	probably damaging	0.97
IGL02977:Tonsl	APN	15	76632873	missense	probably benign	0.00
R0127:Tonsl	UTSW	15	76633485	missense	probably benign	0.01
R0316:Tonsl	UTSW	15	76629300	missense	possibly damaging	0.68
R0443:Tonsl	UTSW	15	76639684	missense	probably benign
R0714:Tonsl	UTSW	15	76633721	splice site	probably benign
R0946:Tonsl	UTSW	15	76623221	missense	probably benign	0.03
R0975:Tonsl	UTSW	15	76638932	missense	probably damaging	0.99
R1263:Tonsl	UTSW	15	76622562	missense	possibly damaging	0.85
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1610:Tonsl	UTSW	15	76638557	missense	probably damaging	1.00
R1623:Tonsl	UTSW	15	76638509	missense	probably damaging	1.00
R1763:Tonsl	UTSW	15	76638066	missense	probably damaging	1.00
R1882:Tonsl	UTSW	15	76624150	missense	possibly damaging	0.83
R1898:Tonsl	UTSW	15	76638853	splice site	probably null
R1932:Tonsl	UTSW	15	76624597	missense	probably damaging	0.97
R2141:Tonsl	UTSW	15	76632661	missense	probably damaging	0.99
R2166:Tonsl	UTSW	15	76637313	missense	probably benign	0.13
R2191:Tonsl	UTSW	15	76632680	missense	probably damaging	0.96
R2198:Tonsl	UTSW	15	76636672	missense	probably benign	0.00
R2219:Tonsl	UTSW	15	76634640	missense	probably damaging	1.00
R2762:Tonsl	UTSW	15	76630620	missense	probably damaging	1.00
R3156:Tonsl	UTSW	15	76639521	missense	probably damaging	1.00
R3508:Tonsl	UTSW	15	76639756	missense	probably benign
R4012:Tonsl	UTSW	15	76637044	missense	probably damaging	1.00
R4179:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4180:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4327:Tonsl	UTSW	15	76639716	missense	probably benign
R4627:Tonsl	UTSW	15	76637224	missense	probably damaging	1.00
R4671:Tonsl	UTSW	15	76623410	missense	probably benign	0.01
R4825:Tonsl	UTSW	15	76633248	missense	probably benign	0.34
R4840:Tonsl	UTSW	15	76633209	missense	probably benign
R5030:Tonsl	UTSW	15	76638101	missense	probably damaging	1.00
R5143:Tonsl	UTSW	15	76636657	missense	possibly damaging	0.80
R6238:Tonsl	UTSW	15	76636218	splice site	probably null
R6379:Tonsl	UTSW	15	76629742	missense	probably benign
R6401:Tonsl	UTSW	15	76633666	missense	probably damaging	1.00
R6534:Tonsl	UTSW	15	76629677	missense	probably damaging	1.00
R6695:Tonsl	UTSW	15	76629818	missense	possibly damaging	0.84
R7138:Tonsl	UTSW	15	76634776	missense	probably benign
R7206:Tonsl	UTSW	15	76633651	missense	probably damaging	1.00
R7287:Tonsl	UTSW	15	76633725	splice site	probably null
R7615:Tonsl	UTSW	15	76630607	missense	probably benign	0.44
R7626:Tonsl	UTSW	15	76633936	missense	probably null	1.00
R7641:Tonsl	UTSW	15	76633652	missense	probably damaging	1.00
R7920:Tonsl	UTSW	15	76634587	missense	probably damaging	1.00
R8245:Tonsl	UTSW	15	76636822	missense	probably benign	0.10
R8311:Tonsl	UTSW	15	76633263	missense	probably benign
R8679:Tonsl	UTSW	15	76632876	missense	probably benign	0.19
R8679:Tonsl	UTSW	15	76634063	missense	probably damaging	1.00
Z1177:Tonsl	UTSW	15	76636153	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- GTTCTCATACCACAAGGGCATG -3'
(R):5'- GCCCCTGTGGTCTTTACAAG -3'

Sequencing Primer
(F):5'- CTCAAGGAGGGTAAGCATGCC -3'
(R):5'- GTGGTCTTTACAAGGCATCTATAACC -3'

Posted On

2018-07-24