Incidental Mutation 'R6702:Per2'
ID 528785
Institutional Source Beutler Lab
Gene Symbol Per2
Ensembl Gene ENSMUSG00000055866
Gene Name period circadian clock 2
Synonyms mPer2
MMRRC Submission 044820-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R6702 (G1)
Quality Score 219.009
Status Validated
Chromosome 1
Chromosomal Location 91415982-91459324 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 91427949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 696 (E696K)
Ref Sequence ENSEMBL: ENSMUSP00000066620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069620]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069620
AA Change: E696K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066620
Gene: ENSMUSG00000055866
AA Change: E696K

DomainStartEndE-ValueType
PAS 179 246 3.23e1 SMART
PAS 319 385 5.75e-2 SMART
PAC 393 436 1.6e0 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 821 834 N/A INTRINSIC
low complexity region 996 1014 N/A INTRINSIC
Pfam:Period_C 1040 1234 2.7e-93 PFAM
Meta Mutation Damage Score 0.1596 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
2810474O19Rik T A 6: 149,327,878 N807K probably damaging Het
Ak3 A G 19: 29,026,227 V183A probably damaging Het
Ano10 G T 9: 122,259,564 Q397K possibly damaging Het
Atg7 C A 6: 114,671,097 probably null Het
Brpf3 A C 17: 28,810,659 N531T probably benign Het
Casp2 T C 6: 42,268,051 V128A probably benign Het
Cdcp2 T C 4: 107,107,086 C378R probably benign Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Ddx54 T A 5: 120,626,503 D758E possibly damaging Het
Dlx2 A G 2: 71,546,227 S56P probably damaging Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnah10 A G 5: 124,805,805 Y2909C probably damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Herpud1 T C 8: 94,392,526 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kif26b C G 1: 178,917,287 S1649R possibly damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Ltbr A G 6: 125,308,068 S290P probably benign Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Nbea A G 3: 56,005,502 Y955H probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1176 G A 2: 88,340,242 V226I probably benign Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdhb13 T G 18: 37,444,775 H735Q probably benign Het
Pcdhb7 A T 18: 37,341,906 M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pld4 T C 12: 112,765,051 S213P probably damaging Het
Prkg1 T A 19: 30,993,084 H209L probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Pxn C T 5: 115,551,896 L160F probably benign Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rgma A T 7: 73,417,320 T108S probably damaging Het
Rxrg A G 1: 167,613,805 S51G probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Sfrp5 G T 19: 42,201,827 T62K probably benign Het
Slco1a6 T A 6: 142,103,100 Y318F probably damaging Het
Slit1 A C 19: 41,614,870 S931A possibly damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Supt6 C A 11: 78,231,800 R199L possibly damaging Het
Tas2r107 A C 6: 131,659,384 M234R probably benign Het
Tmem72 C G 6: 116,698,349 V61L probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Ttn T G 2: 76,720,112 T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubr3 A T 2: 69,956,049 R836W probably benign Het
Umodl1 A G 17: 30,986,299 probably null Het
Ythdf1 A G 2: 180,919,133 probably null Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Zfp811 T C 17: 32,797,842 E407G probably damaging Het
Other mutations in Per2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Per2 APN 1 91448833 missense probably damaging 0.98
IGL01350:Per2 APN 1 91430861 missense probably damaging 1.00
IGL01865:Per2 APN 1 91421517 missense probably benign 0.10
IGL01974:Per2 APN 1 91423718 missense probably benign 0.02
IGL02118:Per2 APN 1 91424309 missense probably damaging 0.99
IGL02271:Per2 APN 1 91445610 missense probably damaging 1.00
IGL02533:Per2 APN 1 91431002 missense possibly damaging 0.92
IGL02707:Per2 APN 1 91450728 missense possibly damaging 0.94
IGL02972:Per2 APN 1 91423981 missense possibly damaging 0.50
IGL03118:Per2 APN 1 91444619 nonsense probably null
IGL03125:Per2 APN 1 91450611 missense probably benign 0.00
IGL03375:Per2 APN 1 91424228 missense possibly damaging 0.76
IGL03388:Per2 APN 1 91444789 splice site probably benign
Kortiku UTSW 1 91423829 missense probably damaging 1.00
obst UTSW 1 91445539 missense probably benign 0.00
R7092_Per2_246 UTSW 1 91421431 missense probably damaging 1.00
rhythm UTSW 1 91429382 critical splice donor site probably null
ANU23:Per2 UTSW 1 91448833 missense probably damaging 0.98
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0542:Per2 UTSW 1 91438332 critical splice donor site probably null
R0764:Per2 UTSW 1 91429420 missense probably damaging 1.00
R1370:Per2 UTSW 1 91445557 missense possibly damaging 0.94
R1655:Per2 UTSW 1 91448768 missense probably damaging 1.00
R1688:Per2 UTSW 1 91423829 missense probably damaging 1.00
R1997:Per2 UTSW 1 91440859 missense probably damaging 1.00
R2891:Per2 UTSW 1 91445603 missense probably damaging 1.00
R2893:Per2 UTSW 1 91445603 missense probably damaging 1.00
R2894:Per2 UTSW 1 91445603 missense probably damaging 1.00
R3109:Per2 UTSW 1 91445575 missense probably benign 0.02
R4125:Per2 UTSW 1 91429450 missense possibly damaging 0.71
R4997:Per2 UTSW 1 91450783 missense probably benign 0.02
R5110:Per2 UTSW 1 91429515 missense possibly damaging 0.57
R5478:Per2 UTSW 1 91432868 missense probably benign 0.09
R5590:Per2 UTSW 1 91427856 nonsense probably null
R5634:Per2 UTSW 1 91444707 missense probably benign 0.02
R5654:Per2 UTSW 1 91445501 splice site probably null
R5928:Per2 UTSW 1 91444651 missense probably damaging 1.00
R6241:Per2 UTSW 1 91421529 missense probably damaging 0.97
R6295:Per2 UTSW 1 91449872 missense unknown
R6345:Per2 UTSW 1 91448722 missense probably damaging 1.00
R6480:Per2 UTSW 1 91429382 critical splice donor site probably null
R6502:Per2 UTSW 1 91427763 missense probably benign 0.01
R6703:Per2 UTSW 1 91427949 missense probably damaging 1.00
R6790:Per2 UTSW 1 91445539 missense probably benign 0.00
R7043:Per2 UTSW 1 91419408 missense probably benign
R7092:Per2 UTSW 1 91421431 missense probably damaging 1.00
R7430:Per2 UTSW 1 91423983 nonsense probably null
R7555:Per2 UTSW 1 91435135 missense probably damaging 1.00
R7860:Per2 UTSW 1 91444759 missense probably damaging 0.99
R8046:Per2 UTSW 1 91435703 missense possibly damaging 0.56
R8142:Per2 UTSW 1 91421547 missense possibly damaging 0.90
R8261:Per2 UTSW 1 91433448 missense possibly damaging 0.87
R8277:Per2 UTSW 1 91420552 missense probably benign 0.15
R8534:Per2 UTSW 1 91423937 missense probably benign 0.09
R8685:Per2 UTSW 1 91450680 missense possibly damaging 0.88
R8703:Per2 UTSW 1 91424045 missense possibly damaging 0.92
R9100:Per2 UTSW 1 91423742 missense possibly damaging 0.91
R9228:Per2 UTSW 1 91438359 missense probably damaging 1.00
R9257:Per2 UTSW 1 91448723 missense probably damaging 1.00
R9429:Per2 UTSW 1 91423767 missense probably benign
X0011:Per2 UTSW 1 91420589 missense possibly damaging 0.85
Z1176:Per2 UTSW 1 91421493 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAATTCACGTCAGCGCTCAC -3'
(R):5'- GACTCCTTTGGAAATCAGAAGC -3'

Sequencing Primer
(F):5'- ACCGCTCCTGGAGATAGTTCTG -3'
(R):5'- CCTTTGGAAATCAGAAGCAGGCATG -3'
Posted On 2018-07-24