Mutagenetix > Incidental Mutations

Incidental Mutation 'R6702:Kif26b'

528788

Institutional Source

Beutler Lab

Gene Symbol

Kif26b

Ensembl Gene

ENSMUSG00000026494

Gene Name

kinesin family member 26B

Synonyms

D230039L06Rik, N-11 kinesin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6702 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

178529125-178939200 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 178917287 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1649 (S1649R)

Ref Sequence

ENSEMBL: ENSMUSP00000124462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160789
AA Change: S1202R

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494
AA Change: S1202R

Domain	Start	End	E-Value	Type
KISc	1	362	2.48e-42	SMART
low complexity region	363	375	N/A	INTRINSIC
low complexity region	402	416	N/A	INTRINSIC
low complexity region	460	466	N/A	INTRINSIC
low complexity region	560	600	N/A	INTRINSIC
low complexity region	652	662	N/A	INTRINSIC
low complexity region	822	841	N/A	INTRINSIC
low complexity region	1038	1048	N/A	INTRINSIC
low complexity region	1294	1322	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161017
AA Change: S1649R

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: S1649R

Domain	Start	End	E-Value	Type
low complexity region	58	123	N/A	INTRINSIC
low complexity region	144	155	N/A	INTRINSIC
low complexity region	220	228	N/A	INTRINSIC
Blast:KISc	365	446	4e-8	BLAST
KISc	448	809	2.48e-42	SMART
low complexity region	810	822	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	907	913	N/A	INTRINSIC
low complexity region	1007	1047	N/A	INTRINSIC
low complexity region	1099	1109	N/A	INTRINSIC
low complexity region	1269	1288	N/A	INTRINSIC
low complexity region	1485	1495	N/A	INTRINSIC
low complexity region	1741	1769	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162545

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

97% (59/61)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	T	A	10: 21,621,659	Y66*	probably null	Het
2810474O19Rik	T	A	6: 149,327,878	N807K	probably damaging	Het
Ak3	A	G	19: 29,026,227	V183A	probably damaging	Het
Ano10	G	T	9: 122,259,564	Q397K	possibly damaging	Het
Atg7	C	A	6: 114,671,097		probably null	Het
Brpf3	A	C	17: 28,810,659	N531T	probably benign	Het
Casp2	T	C	6: 42,268,051	V128A	probably benign	Het
Cdcp2	T	C	4: 107,107,086	C378R	probably benign	Het
Cfap54	T	A	10: 92,868,734	D2828V	unknown	Het
Col6a3	T	C	1: 90,779,439	D1984G	unknown	Het
Csnk2a1	A	G	2: 152,258,688	T93A	probably benign	Het
Ddx54	T	A	5: 120,626,503	D758E	possibly damaging	Het
Dlx2	A	G	2: 71,546,227	S56P	probably damaging	Het
Dna2	T	A	10: 62,973,294	I1055N	possibly damaging	Het
Dnah10	A	G	5: 124,805,805	Y2909C	probably damaging	Het
Dnm3	A	G	1: 162,318,687	F296L	probably benign	Het
Fat1	A	G	8: 44,953,046	T945A	probably benign	Het
Herpud1	T	C	8: 94,392,526		probably null	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Ltbr	A	G	6: 125,308,068	S290P	probably benign	Het
Map4k1	T	G	7: 29,002,396	S803A	possibly damaging	Het
Mef2c	T	A	13: 83,625,406	C134S	possibly damaging	Het
Myo15	A	G	11: 60,492,992	I1622V	probably benign	Het
Nbea	A	G	3: 56,005,502	Y955H	probably benign	Het
Ndor1	A	G	2: 25,249,890	F142S	possibly damaging	Het
Nynrin	A	G	14: 55,864,478	T535A	possibly damaging	Het
Olfr1176	G	A	2: 88,340,242	V226I	probably benign	Het
Olfr1290	T	A	2: 111,490,109		probably null	Het
Olfr205	C	T	16: 59,328,598	V304I	probably benign	Het
Olfr727	A	G	14: 50,127,231	Y218C	probably damaging	Het
Olfr916	A	T	9: 38,657,777	I205N	possibly damaging	Het
Pcdhb13	T	G	18: 37,444,775	H735Q	probably benign	Het
Pcdhb7	A	T	18: 37,341,906	M32L	probably benign	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Per2	C	T	1: 91,427,949	E696K	probably damaging	Het
Pld4	T	C	12: 112,765,051	S213P	probably damaging	Het
Prkg1	T	A	19: 30,993,084	H209L	probably benign	Het
Psg16	T	C	7: 17,090,396	L35P	probably damaging	Het
Pxn	C	T	5: 115,551,896	L160F	probably benign	Het
Rab3a	A	G	8: 70,756,448	D77G	probably damaging	Het
Rgma	A	T	7: 73,417,320	T108S	probably damaging	Het
Rxrg	A	G	1: 167,613,805	S51G	probably benign	Het
S1pr3	A	T	13: 51,419,439	I219F	probably damaging	Het
Sec23b	A	T	2: 144,559,189		probably null	Het
Sfrp5	G	T	19: 42,201,827	T62K	probably benign	Het
Slco1a6	T	A	6: 142,103,100	Y318F	probably damaging	Het
Slit1	A	C	19: 41,614,870	S931A	possibly damaging	Het
Sorl1	A	T	9: 42,071,201	V361E	probably damaging	Het
St6galnac2	A	G	11: 116,684,387	S209P	probably benign	Het
Supt6	C	A	11: 78,231,800	R199L	possibly damaging	Het
Tas2r107	A	C	6: 131,659,384	M234R	probably benign	Het
Tmem72	C	G	6: 116,698,349	V61L	probably benign	Het
Trpm5	C	A	7: 143,069,318		probably benign	Het
Ttn	T	G	2: 76,720,112	T23282P	probably damaging	Het
Ubap2	GCCCGCTTGCCCCGCT	GCCCGCTTGCCCCGCTTGCCCCGCT	4: 41,227,210		probably benign	Het
Ubr3	A	T	2: 69,956,049	R836W	probably benign	Het
Umodl1	A	G	17: 30,986,299		probably null	Het
Ythdf1	A	G	2: 180,919,133		probably null	Het
Zfp780b	T	C	7: 27,971,641	T81A	possibly damaging	Het
Zfp811	T	C	17: 32,797,842	E407G	probably damaging	Het

Other mutations in Kif26b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Kif26b	APN	1	178915648	missense	probably damaging	1.00
IGL00425:Kif26b	APN	1	178916301	missense	probably damaging	0.96
IGL00952:Kif26b	APN	1	178932205	missense	probably damaging	1.00
IGL01100:Kif26b	APN	1	178917244	missense	probably benign
IGL01347:Kif26b	APN	1	178870675	missense	probably damaging	1.00
IGL01543:Kif26b	APN	1	178678961	missense	probably benign	0.41
IGL01938:Kif26b	APN	1	178916038	missense	probably damaging	0.99
IGL02100:Kif26b	APN	1	178915947	missense	probably damaging	0.99
IGL02262:Kif26b	APN	1	178916068	missense	probably benign	0.05
IGL02576:Kif26b	APN	1	178916347	missense	probably benign
IGL02673:Kif26b	APN	1	178821605	missense	probably damaging	1.00
IGL03078:Kif26b	APN	1	178870726	missense	probably damaging	1.00
IGL03155:Kif26b	APN	1	178874128	missense	probably damaging	1.00
IGL03157:Kif26b	APN	1	178916365	missense	probably damaging	1.00
IGL03162:Kif26b	APN	1	178916932	missense	probably benign
IGL03220:Kif26b	APN	1	178864869	missense	probably damaging	1.00
IGL03299:Kif26b	APN	1	178821560	missense	probably benign	0.09
IGL03368:Kif26b	APN	1	178916208	missense	probably damaging	1.00
IGL03370:Kif26b	APN	1	178915381	missense	probably benign	0.39
PIT4449001:Kif26b	UTSW	1	178918086	missense	probably damaging	1.00
R0142:Kif26b	UTSW	1	178915389	missense	probably damaging	1.00
R0621:Kif26b	UTSW	1	178915653	missense	probably benign	0.02
R0987:Kif26b	UTSW	1	178821620	missense	probably damaging	1.00
R1107:Kif26b	UTSW	1	178917673	missense	probably benign	0.03
R1367:Kif26b	UTSW	1	178916463	missense	probably damaging	1.00
R1386:Kif26b	UTSW	1	178915644	missense	probably benign
R1619:Kif26b	UTSW	1	178916478	missense	probably benign	0.00
R1664:Kif26b	UTSW	1	178932139	missense	probably damaging	1.00
R2240:Kif26b	UTSW	1	178715923	missense	probably benign	0.00
R2264:Kif26b	UTSW	1	178928842	critical splice acceptor site	probably null
R2443:Kif26b	UTSW	1	178915014	missense	probably damaging	0.99
R3023:Kif26b	UTSW	1	178864868	missense	probably damaging	0.99
R3744:Kif26b	UTSW	1	178679030	missense	probably benign	0.00
R3831:Kif26b	UTSW	1	178916616	frame shift	probably null
R3832:Kif26b	UTSW	1	178916616	frame shift	probably null
R3833:Kif26b	UTSW	1	178916616	frame shift	probably null
R3843:Kif26b	UTSW	1	178928177	missense	probably damaging	1.00
R4108:Kif26b	UTSW	1	178916965	missense	possibly damaging	0.88
R4181:Kif26b	UTSW	1	178915426	missense	probably damaging	0.98
R4551:Kif26b	UTSW	1	178884035	missense	probably damaging	1.00
R4552:Kif26b	UTSW	1	178884035	missense	probably damaging	1.00
R4597:Kif26b	UTSW	1	178916793	missense	probably damaging	1.00
R4599:Kif26b	UTSW	1	178530459	missense	unknown
R4610:Kif26b	UTSW	1	178679355	missense	probably damaging	1.00
R4746:Kif26b	UTSW	1	178873981	nonsense	probably null
R4873:Kif26b	UTSW	1	178915327	missense	probably benign	0.38
R4875:Kif26b	UTSW	1	178915327	missense	probably benign	0.38
R5015:Kif26b	UTSW	1	178928330	missense	probably damaging	0.99
R5060:Kif26b	UTSW	1	178530630	missense	unknown
R5301:Kif26b	UTSW	1	178530668	missense	unknown
R5368:Kif26b	UTSW	1	178915884	missense	probably damaging	1.00
R5387:Kif26b	UTSW	1	178914876	missense	probably benign	0.01
R5589:Kif26b	UTSW	1	178916299	missense	probably benign	0.05
R6150:Kif26b	UTSW	1	178915546	missense	probably damaging	1.00
R6259:Kif26b	UTSW	1	178917405	missense	probably damaging	0.97
R6355:Kif26b	UTSW	1	178916178	missense	probably damaging	1.00
R6408:Kif26b	UTSW	1	178917568	missense	probably damaging	1.00
R6488:Kif26b	UTSW	1	178529573	missense	unknown
R6546:Kif26b	UTSW	1	178928306	missense	probably damaging	1.00
R6886:Kif26b	UTSW	1	178874138	missense	probably damaging	1.00
R6953:Kif26b	UTSW	1	178874072	missense	possibly damaging	0.89
R7262:Kif26b	UTSW	1	178917654	missense	possibly damaging	0.84
R7291:Kif26b	UTSW	1	178679046	missense	possibly damaging	0.86
R7346:Kif26b	UTSW	1	178530741	missense	probably damaging	1.00
R7383:Kif26b	UTSW	1	178530710	missense	probably damaging	1.00
R7448:Kif26b	UTSW	1	178914774	missense	probably damaging	1.00
R7506:Kif26b	UTSW	1	178529499	start gained	probably benign
R7562:Kif26b	UTSW	1	178914976	missense	probably damaging	1.00
R7583:Kif26b	UTSW	1	178530445	nonsense	probably null
R7585:Kif26b	UTSW	1	178916496	missense	probably benign	0.01
R7644:Kif26b	UTSW	1	178679274	missense	probably benign	0.04
R7759:Kif26b	UTSW	1	178678944	missense	probably damaging	1.00
R7775:Kif26b	UTSW	1	178864876	missense	probably benign	0.15
R7954:Kif26b	UTSW	1	178869379	missense	probably damaging	0.99
R7960:Kif26b	UTSW	1	178678919	missense	probably damaging	1.00
R8012:Kif26b	UTSW	1	178916250	missense	probably benign	0.20
R8152:Kif26b	UTSW	1	178679229	missense	possibly damaging	0.46
R8320:Kif26b	UTSW	1	178884076	critical splice donor site	probably null
R8360:Kif26b	UTSW	1	178916373	missense	probably benign	0.18
R8428:Kif26b	UTSW	1	178917358	missense	probably benign	0.09
R8670:Kif26b	UTSW	1	178913784	missense	probably damaging	1.00
R8737:Kif26b	UTSW	1	178864865	missense	probably damaging	0.99
R8788:Kif26b	UTSW	1	178529525	start gained	probably benign
R8854:Kif26b	UTSW	1	178916383	missense	possibly damaging	0.93
R8870:Kif26b	UTSW	1	178865029	missense	probably damaging	1.00
R8963:Kif26b	UTSW	1	178916149	missense	probably benign	0.00
X0021:Kif26b	UTSW	1	178928159	missense	probably damaging	1.00
X0024:Kif26b	UTSW	1	178679082	missense	probably benign	0.14
X0025:Kif26b	UTSW	1	178915266	nonsense	probably null
X0025:Kif26b	UTSW	1	178915383	missense	possibly damaging	0.70
Z1177:Kif26b	UTSW	1	178821548	missense	probably benign	0.11
Z1177:Kif26b	UTSW	1	178821550	nonsense	probably null
Z1177:Kif26b	UTSW	1	178915405	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTCACCCAAGCATTGCGTCC -3'
(R):5'- ACTGAGTGATGCCACAGCTG -3'

Sequencing Primer
(F):5'- CTAGCTTGGACCAGAAGA -3'
(R):5'- CACAGCTGGGTGGTGAG -3'

Posted On

2018-07-24