Mutagenetix > Incidental Mutation

Incidental Mutation 'R6702:Sec23b'

528795

Institutional Source

Beutler Lab

Gene Symbol

Sec23b

Ensembl Gene

ENSMUSG00000027429

Gene Name

SEC23 homolog B, COPII coat complex component

Synonyms

MMRRC Submission

044820-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6702 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144556229-144590749 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 144559189 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122884 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028916] [ENSMUST00000143573] [ENSMUST00000149697] [ENSMUST00000155258] [ENSMUST00000155876]

AlphaFold

Q9D662

Predicted Effect

probably null
Transcript: ENSMUST00000028916

SMART Domains

Protein: ENSMUSP00000028916
Gene: ENSMUSG00000027429

Domain	Start	End	E-Value	Type
Pfam:zf-Sec23_Sec24	58	98	4.3e-17	PFAM
Pfam:Sec23_trunk	126	392	2.3e-82	PFAM
Pfam:Sec23_BS	403	506	7.2e-33	PFAM
Pfam:Sec23_helical	522	620	1.1e-28	PFAM
Pfam:Gelsolin	631	720	1e-18	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000143573

SMART Domains

Protein: ENSMUSP00000120972
Gene: ENSMUSG00000027429

Domain	Start	End	E-Value	Type
Pfam:zf-Sec23_Sec24	57	98	3.7e-18	PFAM
Pfam:Sec23_trunk	126	278	1.3e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143921

Predicted Effect

probably null
Transcript: ENSMUST00000149697

SMART Domains

Protein: ENSMUSP00000122819
Gene: ENSMUSG00000027429

Domain	Start	End	E-Value	Type
Pfam:zf-Sec23_Sec24	57	98	8.7e-19	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000155258

SMART Domains

Protein: ENSMUSP00000123690
Gene: ENSMUSG00000027429

Domain	Start	End	E-Value	Type
PDB:2NUT\|A	1	59	2e-32	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000155876

SMART Domains

Protein: ENSMUSP00000122884
Gene: ENSMUSG00000027429

Domain	Start	End	E-Value	Type
Pfam:zf-Sec23_Sec24	57	98	1.1e-18	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The function of this gene product has been implicated in cargo selection and concentration. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display complete neonatal lethality, fail to suckle, and show degeneration of the secretory tissues in the pancreas, salivary gland, and gastric glands. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	T	A	10: 21,621,659	Y66*	probably null	Het
2810474O19Rik	T	A	6: 149,327,878	N807K	probably damaging	Het
Ak3	A	G	19: 29,026,227	V183A	probably damaging	Het
Ano10	G	T	9: 122,259,564	Q397K	possibly damaging	Het
Atg7	C	A	6: 114,671,097		probably null	Het
Brpf3	A	C	17: 28,810,659	N531T	probably benign	Het
Casp2	T	C	6: 42,268,051	V128A	probably benign	Het
Cdcp2	T	C	4: 107,107,086	C378R	probably benign	Het
Cfap54	T	A	10: 92,868,734	D2828V	unknown	Het
Col6a3	T	C	1: 90,779,439	D1984G	unknown	Het
Csnk2a1	A	G	2: 152,258,688	T93A	probably benign	Het
Ddx54	T	A	5: 120,626,503	D758E	possibly damaging	Het
Dlx2	A	G	2: 71,546,227	S56P	probably damaging	Het
Dna2	T	A	10: 62,973,294	I1055N	possibly damaging	Het
Dnah10	A	G	5: 124,805,805	Y2909C	probably damaging	Het
Dnm3	A	G	1: 162,318,687	F296L	probably benign	Het
Fat1	A	G	8: 44,953,046	T945A	probably benign	Het
Herpud1	T	C	8: 94,392,526		probably null	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Kif26b	C	G	1: 178,917,287	S1649R	possibly damaging	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Ltbr	A	G	6: 125,308,068	S290P	probably benign	Het
Map4k1	T	G	7: 29,002,396	S803A	possibly damaging	Het
Mef2c	T	A	13: 83,625,406	C134S	possibly damaging	Het
Myo15	A	G	11: 60,492,992	I1622V	probably benign	Het
Nbea	A	G	3: 56,005,502	Y955H	probably benign	Het
Ndor1	A	G	2: 25,249,890	F142S	possibly damaging	Het
Nynrin	A	G	14: 55,864,478	T535A	possibly damaging	Het
Olfr1176	G	A	2: 88,340,242	V226I	probably benign	Het
Olfr1290	T	A	2: 111,490,109		probably null	Het
Olfr205	C	T	16: 59,328,598	V304I	probably benign	Het
Olfr727	A	G	14: 50,127,231	Y218C	probably damaging	Het
Olfr916	A	T	9: 38,657,777	I205N	possibly damaging	Het
Pcdhb13	T	G	18: 37,444,775	H735Q	probably benign	Het
Pcdhb7	A	T	18: 37,341,906	M32L	probably benign	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Per2	C	T	1: 91,427,949	E696K	probably damaging	Het
Pld4	T	C	12: 112,765,051	S213P	probably damaging	Het
Prkg1	T	A	19: 30,993,084	H209L	probably benign	Het
Psg16	T	C	7: 17,090,396	L35P	probably damaging	Het
Pxn	C	T	5: 115,551,896	L160F	probably benign	Het
Rab3a	A	G	8: 70,756,448	D77G	probably damaging	Het
Rgma	A	T	7: 73,417,320	T108S	probably damaging	Het
Rxrg	A	G	1: 167,613,805	S51G	probably benign	Het
S1pr3	A	T	13: 51,419,439	I219F	probably damaging	Het
Sfrp5	G	T	19: 42,201,827	T62K	probably benign	Het
Slco1a6	T	A	6: 142,103,100	Y318F	probably damaging	Het
Slit1	A	C	19: 41,614,870	S931A	possibly damaging	Het
Sorl1	A	T	9: 42,071,201	V361E	probably damaging	Het
St6galnac2	A	G	11: 116,684,387	S209P	probably benign	Het
Supt6	C	A	11: 78,231,800	R199L	possibly damaging	Het
Tas2r107	A	C	6: 131,659,384	M234R	probably benign	Het
Tmem72	C	G	6: 116,698,349	V61L	probably benign	Het
Trpm5	C	A	7: 143,069,318		probably benign	Het
Ttn	T	G	2: 76,720,112	T23282P	probably damaging	Het
Ubap2	GCCCGCTTGCCCCGCT	GCCCGCTTGCCCCGCTTGCCCCGCT	4: 41,227,210		probably benign	Het
Ubr3	A	T	2: 69,956,049	R836W	probably benign	Het
Umodl1	A	G	17: 30,986,299		probably null	Het
Ythdf1	A	G	2: 180,919,133		probably null	Het
Zfp780b	T	C	7: 27,971,641	T81A	possibly damaging	Het
Zfp811	T	C	17: 32,797,842	E407G	probably damaging	Het

Other mutations in Sec23b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00659:Sec23b	APN	2	144583770	critical splice donor site	probably null
IGL00668:Sec23b	APN	2	144559218	utr 5 prime	probably benign
IGL00714:Sec23b	APN	2	144559225	missense	probably benign	0.33
IGL00914:Sec23b	APN	2	144566864	missense	probably damaging	1.00
IGL01084:Sec23b	APN	2	144564589	missense	possibly damaging	0.81
IGL01341:Sec23b	APN	2	144585733	missense	probably benign	0.00
IGL01377:Sec23b	APN	2	144559237	missense	probably damaging	0.97
IGL01634:Sec23b	APN	2	144559230	missense	probably damaging	0.96
IGL02321:Sec23b	APN	2	144579405	critical splice donor site	probably null
IGL03027:Sec23b	APN	2	144587545	missense	possibly damaging	0.55
IGL03064:Sec23b	APN	2	144582032	missense	probably benign	0.00
IGL03105:Sec23b	APN	2	144582020	missense	probably damaging	1.00
IGL03240:Sec23b	APN	2	144566759	splice site	probably benign
R0004:Sec23b	UTSW	2	144564562	splice site	probably benign
R0092:Sec23b	UTSW	2	144566910	missense	probably benign	0.21
R0409:Sec23b	UTSW	2	144567912	missense	probably benign	0.22
R0426:Sec23b	UTSW	2	144568612	unclassified	probably benign
R0441:Sec23b	UTSW	2	144581997	missense	probably damaging	1.00
R1034:Sec23b	UTSW	2	144590338	missense	possibly damaging	0.87
R1624:Sec23b	UTSW	2	144567129	missense	probably benign
R2020:Sec23b	UTSW	2	144566944	missense	possibly damaging	0.49
R2392:Sec23b	UTSW	2	144585587	splice site	probably null
R3946:Sec23b	UTSW	2	144581973	missense	probably benign
R4407:Sec23b	UTSW	2	144574718	missense	possibly damaging	0.53
R4448:Sec23b	UTSW	2	144559251	missense	probably benign	0.43
R4519:Sec23b	UTSW	2	144582015	missense	possibly damaging	0.86
R4522:Sec23b	UTSW	2	144578366	missense	possibly damaging	0.80
R4654:Sec23b	UTSW	2	144572574	missense	probably benign	0.33
R4849:Sec23b	UTSW	2	144585599	missense	probably damaging	0.96
R4876:Sec23b	UTSW	2	144586361	splice site	probably null
R4983:Sec23b	UTSW	2	144581953	missense	probably benign	0.06
R6169:Sec23b	UTSW	2	144586974	missense	probably damaging	1.00
R6703:Sec23b	UTSW	2	144559189	splice site	probably null
R6748:Sec23b	UTSW	2	144566794	missense	probably damaging	1.00
R7238:Sec23b	UTSW	2	144590338	missense	possibly damaging	0.87
R7511:Sec23b	UTSW	2	144590349	missense	probably benign	0.30
R7845:Sec23b	UTSW	2	144559396	missense	possibly damaging	0.67
R7914:Sec23b	UTSW	2	144564645	missense	probably benign
R8177:Sec23b	UTSW	2	144585623	missense	probably benign	0.03
R8183:Sec23b	UTSW	2	144559269	missense	probably benign	0.08
R8238:Sec23b	UTSW	2	144564648	missense	probably benign	0.00
R8420:Sec23b	UTSW	2	144559314	missense	probably benign	0.01
R8488:Sec23b	UTSW	2	144582063	missense	probably damaging	0.98
R8558:Sec23b	UTSW	2	144586388	missense	possibly damaging	0.90
R8911:Sec23b	UTSW	2	144559396	missense	probably benign	0.27
R8939:Sec23b	UTSW	2	144569217	critical splice donor site	probably null
R9058:Sec23b	UTSW	2	144582090	missense	probably damaging	1.00
R9172:Sec23b	UTSW	2	144559259	missense	probably benign
R9334:Sec23b	UTSW	2	144568630	missense	possibly damaging	0.83
R9401:Sec23b	UTSW	2	144578366	missense	probably benign	0.10
R9561:Sec23b	UTSW	2	144566808	missense	possibly damaging	0.84
R9593:Sec23b	UTSW	2	144568644	missense	probably benign	0.20
R9696:Sec23b	UTSW	2	144586423	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGTCCAAGAGAAGGTAGTTACC -3'
(R):5'- CTGCAAAGCACAGGTTCATACTG -3'

Sequencing Primer
(F):5'- ACCTTTATCCTGTAGTGATGGGC -3'
(R):5'- GCACAGGTTCATACTGTACAGG -3'

Posted On

2018-07-24