Incidental Mutation 'R6702:Peg10'
ID528804
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Namepaternally expressed 10
SynonymsHB-1, MyEF-3, Mart2, Mar2, MyEF-3 like, MEF3L, Edr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6702 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location4747306-4760517 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GC to GCTCC at 4756452 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
2810474O19Rik T A 6: 149,327,878 N807K probably damaging Het
Ak3 A G 19: 29,026,227 V183A probably damaging Het
Ano10 G T 9: 122,259,564 Q397K possibly damaging Het
Atg7 C A 6: 114,671,097 probably null Het
Brpf3 A C 17: 28,810,659 N531T probably benign Het
Casp2 T C 6: 42,268,051 V128A probably benign Het
Cdcp2 T C 4: 107,107,086 C378R probably benign Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Ddx54 T A 5: 120,626,503 D758E possibly damaging Het
Dlx2 A G 2: 71,546,227 S56P probably damaging Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnah10 A G 5: 124,805,805 Y2909C probably damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Herpud1 T C 8: 94,392,526 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kif26b C G 1: 178,917,287 S1649R possibly damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Ltbr A G 6: 125,308,068 S290P probably benign Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Nbea A G 3: 56,005,502 Y955H probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1176 G A 2: 88,340,242 V226I probably benign Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdhb13 T G 18: 37,444,775 H735Q probably benign Het
Pcdhb7 A T 18: 37,341,906 M32L probably benign Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pld4 T C 12: 112,765,051 S213P probably damaging Het
Prkg1 T A 19: 30,993,084 H209L probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Pxn C T 5: 115,551,896 L160F probably benign Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rgma A T 7: 73,417,320 T108S probably damaging Het
Rxrg A G 1: 167,613,805 S51G probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Sfrp5 G T 19: 42,201,827 T62K probably benign Het
Slco1a6 T A 6: 142,103,100 Y318F probably damaging Het
Slit1 A C 19: 41,614,870 S931A possibly damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Supt6 C A 11: 78,231,800 R199L possibly damaging Het
Tas2r107 A C 6: 131,659,384 M234R probably benign Het
Tmem72 C G 6: 116,698,349 V61L probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Ttn T G 2: 76,720,112 T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubr3 A T 2: 69,956,049 R836W probably benign Het
Umodl1 A G 17: 30,986,299 probably null Het
Ythdf1 A G 2: 180,919,133 probably null Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Zfp811 T C 17: 32,797,842 E407G probably damaging Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4754473 utr 5 prime probably benign
IGL03063:Peg10 APN 6 4756647 utr 3 prime probably benign
piaggio UTSW 6 4756427 utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4756560 missense unknown
R0090:Peg10 UTSW 6 4756063 utr 3 prime probably benign
R0148:Peg10 UTSW 6 4755711 missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4756475 small insertion probably benign
R0698:Peg10 UTSW 6 4756835 utr 3 prime probably benign
R1600:Peg10 UTSW 6 4757080 utr 3 prime probably benign
R1842:Peg10 UTSW 6 4756381 utr 3 prime probably benign
R1930:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R1931:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R2162:Peg10 UTSW 6 4755914 utr 3 prime probably benign
R2215:Peg10 UTSW 6 4756918 utr 3 prime probably benign
R2339:Peg10 UTSW 6 4756102 utr 3 prime probably benign
R2847:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R2848:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R3000:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R3056:Peg10 UTSW 6 4755029 missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4754534 missense probably benign 0.00
R4059:Peg10 UTSW 6 4756427 utr 3 prime probably benign
R4296:Peg10 UTSW 6 4756472 small insertion probably benign
R4626:Peg10 UTSW 6 4756460 small insertion probably benign
R4634:Peg10 UTSW 6 4756452 small insertion probably benign
R4679:Peg10 UTSW 6 4756452 small insertion probably benign
R4834:Peg10 UTSW 6 4754294 utr 5 prime probably benign
R4982:Peg10 UTSW 6 4756451 small insertion probably benign
R4983:Peg10 UTSW 6 4756451 small insertion probably benign
R4996:Peg10 UTSW 6 4756454 small insertion probably benign
R4997:Peg10 UTSW 6 4756457 small insertion probably benign
R5015:Peg10 UTSW 6 4756453 small insertion probably benign
R5085:Peg10 UTSW 6 4755864 utr 3 prime probably benign
R5091:Peg10 UTSW 6 4754511 missense probably benign 0.01
R5231:Peg10 UTSW 6 4756939 utr 3 prime probably benign
R5278:Peg10 UTSW 6 4756442 small deletion probably benign
R5364:Peg10 UTSW 6 4756128 utr 3 prime probably benign
R5397:Peg10 UTSW 6 4756453 small insertion probably benign
R5485:Peg10 UTSW 6 4755565 missense probably benign 0.09
R5573:Peg10 UTSW 6 4755913 utr 3 prime probably benign
R5710:Peg10 UTSW 6 4756350 small insertion probably benign
R5710:Peg10 UTSW 6 4756351 small insertion probably benign
R5736:Peg10 UTSW 6 4754423 missense probably benign 0.00
R5865:Peg10 UTSW 6 4754375 missense probably damaging 0.98
R6056:Peg10 UTSW 6 4756449 small insertion probably benign
R6116:Peg10 UTSW 6 4756351 small insertion probably benign
R6129:Peg10 UTSW 6 4756449 small insertion probably benign
R6147:Peg10 UTSW 6 4754499 start gained probably benign
R6171:Peg10 UTSW 6 4756449 small insertion probably benign
R6194:Peg10 UTSW 6 4756351 small insertion probably benign
R6197:Peg10 UTSW 6 4756452 small insertion probably benign
R6207:Peg10 UTSW 6 4756449 small insertion probably benign
R6215:Peg10 UTSW 6 4756452 small insertion probably benign
R6276:Peg10 UTSW 6 4756449 small insertion probably benign
R6281:Peg10 UTSW 6 4756449 small insertion probably benign
R6287:Peg10 UTSW 6 4756451 small insertion probably benign
R6302:Peg10 UTSW 6 4756449 small insertion probably benign
R6393:Peg10 UTSW 6 4756452 small insertion probably benign
R6394:Peg10 UTSW 6 4756451 small insertion probably benign
R6405:Peg10 UTSW 6 4756453 small insertion probably benign
R6421:Peg10 UTSW 6 4756449 small insertion probably benign
R6486:Peg10 UTSW 6 4756449 small insertion probably benign
R6538:Peg10 UTSW 6 4756449 small insertion probably benign
R6668:Peg10 UTSW 6 4754502 missense probably benign 0.01
R6679:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R6685:Peg10 UTSW 6 4754738 missense probably damaging 1.00
R6706:Peg10 UTSW 6 4756452 small insertion probably benign
R6747:Peg10 UTSW 6 4757137 utr 3 prime probably benign
R6775:Peg10 UTSW 6 4756452 small insertion probably benign
R6811:Peg10 UTSW 6 4756451 small insertion probably benign
R6823:Peg10 UTSW 6 4756431 small deletion probably benign
R6826:Peg10 UTSW 6 4756353 small insertion probably benign
R6847:Peg10 UTSW 6 4754279 utr 5 prime probably benign
R6861:Peg10 UTSW 6 4756350 small insertion probably benign
R6861:Peg10 UTSW 6 4756351 small insertion probably benign
R6876:Peg10 UTSW 6 4756451 small insertion probably benign
R6891:Peg10 UTSW 6 4756449 small insertion probably benign
R6911:Peg10 UTSW 6 4756452 small insertion probably benign
R6973:Peg10 UTSW 6 4756431 small deletion probably benign
R6990:Peg10 UTSW 6 4756451 small insertion probably benign
R6998:Peg10 UTSW 6 4756398 small deletion probably benign
R7070:Peg10 UTSW 6 4756454 small insertion probably benign
R7120:Peg10 UTSW 6 4756398 small deletion probably benign
R7132:Peg10 UTSW 6 4756398 small deletion probably benign
R7140:Peg10 UTSW 6 4756452 small insertion probably benign
R7189:Peg10 UTSW 6 4756431 small deletion probably benign
R7208:Peg10 UTSW 6 4756398 small deletion probably benign
R7256:Peg10 UTSW 6 4756398 small deletion probably benign
R7260:Peg10 UTSW 6 4756398 small deletion probably benign
R7261:Peg10 UTSW 6 4756591 missense unknown
R7401:Peg10 UTSW 6 4756452 small insertion probably benign
R7409:Peg10 UTSW 6 4756398 small deletion probably benign
R7439:Peg10 UTSW 6 4756453 small insertion probably benign
R7475:Peg10 UTSW 6 4756398 small deletion probably benign
R7483:Peg10 UTSW 6 4756451 small insertion probably benign
R7502:Peg10 UTSW 6 4756398 small deletion probably benign
R7515:Peg10 UTSW 6 4756452 small insertion probably benign
R7520:Peg10 UTSW 6 4756796 missense unknown
R7544:Peg10 UTSW 6 4756427 frame shift probably null
R7571:Peg10 UTSW 6 4756082 missense unknown
R7581:Peg10 UTSW 6 4756452 small insertion probably benign
R7635:Peg10 UTSW 6 4754938 missense probably damaging 0.99
R7677:Peg10 UTSW 6 4756398 small deletion probably benign
R7697:Peg10 UTSW 6 4756453 small insertion probably benign
R7710:Peg10 UTSW 6 4756452 small insertion probably benign
R7803:Peg10 UTSW 6 4756431 small deletion probably benign
R7816:Peg10 UTSW 6 4756453 small insertion probably benign
R7820:Peg10 UTSW 6 4756398 small deletion probably benign
R7827:Peg10 UTSW 6 4756452 small insertion probably benign
R7861:Peg10 UTSW 6 4756431 small deletion probably benign
R7881:Peg10 UTSW 6 4756454 small insertion probably benign
R7904:Peg10 UTSW 6 4756452 small insertion probably benign
R7915:Peg10 UTSW 6 4756451 small insertion probably benign
R7916:Peg10 UTSW 6 4756451 small insertion probably benign
R7963:Peg10 UTSW 6 4756452 small insertion probably benign
R8016:Peg10 UTSW 6 4756451 small insertion probably benign
R8037:Peg10 UTSW 6 4756398 small deletion probably benign
R8062:Peg10 UTSW 6 4756398 small deletion probably benign
R8081:Peg10 UTSW 6 4756452 small insertion probably benign
R8113:Peg10 UTSW 6 4756451 small insertion probably benign
R8115:Peg10 UTSW 6 4756707 missense unknown
R8140:Peg10 UTSW 6 4756113 missense unknown
R8178:Peg10 UTSW 6 4756452 small insertion probably benign
R8233:Peg10 UTSW 6 4756453 small insertion probably benign
R8239:Peg10 UTSW 6 4756452 small insertion probably benign
R8281:Peg10 UTSW 6 4756431 small deletion probably benign
R8310:Peg10 UTSW 6 4756454 small insertion probably benign
R8312:Peg10 UTSW 6 4756452 small insertion probably benign
R8330:Peg10 UTSW 6 4756452 small insertion probably benign
R8338:Peg10 UTSW 6 4756398 small deletion probably benign
R8387:Peg10 UTSW 6 4756452 small insertion probably benign
R8390:Peg10 UTSW 6 4756451 small insertion probably benign
X0065:Peg10 UTSW 6 4756515 utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4756451 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTGTTTACAGTGCCACAACCG -3'
(R):5'- ACCTTACAGGGTGGTAAATTCTG -3'

Sequencing Primer
(F):5'- TCAGCATGAGCATCTGCATG -3'
(R):5'- GGTGGTAAATTCTGAATCCAGCC -3'
Posted On2018-07-24