Incidental Mutation 'R6702:Psg16'
ID 528812
Institutional Source Beutler Lab
Gene Symbol Psg16
Ensembl Gene ENSMUSG00000066760
Gene Name pregnancy specific glycoprotein 16
Synonyms bCEA, Cea11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6702 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 17074040-17133450 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17090396 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 35 (L35P)
Ref Sequence ENSEMBL: ENSMUSP00000118977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071399] [ENSMUST00000118367] [ENSMUST00000152671]
AlphaFold Q8K0U8
Predicted Effect probably benign
Transcript: ENSMUST00000071399
SMART Domains Protein: ENSMUSP00000071348
Gene: ENSMUSG00000066760

DomainStartEndE-ValueType
IG_like 6 52 1.42e2 SMART
IG 71 172 1.21e-2 SMART
IG 191 292 2.56e-1 SMART
IG_like 302 395 5.13e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118367
SMART Domains Protein: ENSMUSP00000113025
Gene: ENSMUSG00000066760

DomainStartEndE-ValueType
IG_like 6 52 1.42e2 SMART
IG 71 172 1.21e-2 SMART
IG 191 292 2.56e-1 SMART
IGc2 308 372 3.56e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131153
Predicted Effect probably damaging
Transcript: ENSMUST00000152671
AA Change: L35P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118977
Gene: ENSMUSG00000066760
AA Change: L35P

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
IG 46 143 4.29e-3 SMART
IG 162 261 2.94e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
2810474O19Rik T A 6: 149,327,878 N807K probably damaging Het
Ak3 A G 19: 29,026,227 V183A probably damaging Het
Ano10 G T 9: 122,259,564 Q397K possibly damaging Het
Atg7 C A 6: 114,671,097 probably null Het
Brpf3 A C 17: 28,810,659 N531T probably benign Het
Casp2 T C 6: 42,268,051 V128A probably benign Het
Cdcp2 T C 4: 107,107,086 C378R probably benign Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Ddx54 T A 5: 120,626,503 D758E possibly damaging Het
Dlx2 A G 2: 71,546,227 S56P probably damaging Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnah10 A G 5: 124,805,805 Y2909C probably damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Herpud1 T C 8: 94,392,526 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kif26b C G 1: 178,917,287 S1649R possibly damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Ltbr A G 6: 125,308,068 S290P probably benign Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Nbea A G 3: 56,005,502 Y955H probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1176 G A 2: 88,340,242 V226I probably benign Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdhb13 T G 18: 37,444,775 H735Q probably benign Het
Pcdhb7 A T 18: 37,341,906 M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pld4 T C 12: 112,765,051 S213P probably damaging Het
Prkg1 T A 19: 30,993,084 H209L probably benign Het
Pxn C T 5: 115,551,896 L160F probably benign Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rgma A T 7: 73,417,320 T108S probably damaging Het
Rxrg A G 1: 167,613,805 S51G probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Sfrp5 G T 19: 42,201,827 T62K probably benign Het
Slco1a6 T A 6: 142,103,100 Y318F probably damaging Het
Slit1 A C 19: 41,614,870 S931A possibly damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Supt6 C A 11: 78,231,800 R199L possibly damaging Het
Tas2r107 A C 6: 131,659,384 M234R probably benign Het
Tmem72 C G 6: 116,698,349 V61L probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Ttn T G 2: 76,720,112 T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubr3 A T 2: 69,956,049 R836W probably benign Het
Umodl1 A G 17: 30,986,299 probably null Het
Ythdf1 A G 2: 180,919,133 probably null Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Zfp811 T C 17: 32,797,842 E407G probably damaging Het
Other mutations in Psg16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Psg16 APN 7 17093706 missense probably benign 0.08
IGL02258:Psg16 APN 7 17095292 missense probably damaging 1.00
R0379:Psg16 UTSW 7 17130658 missense probably benign 0.09
R0389:Psg16 UTSW 7 17095163 missense probably benign
R0443:Psg16 UTSW 7 17095163 missense probably benign
R1231:Psg16 UTSW 7 17095305 nonsense probably null
R1594:Psg16 UTSW 7 17093823 missense probably damaging 1.00
R2064:Psg16 UTSW 7 17093748 missense possibly damaging 0.91
R2118:Psg16 UTSW 7 17090623 missense probably benign 0.33
R3806:Psg16 UTSW 7 17090684 missense probably benign 0.24
R4397:Psg16 UTSW 7 17090698 missense possibly damaging 0.68
R4583:Psg16 UTSW 7 17095172 missense probably benign 0.01
R4685:Psg16 UTSW 7 17090534 missense probably benign 0.00
R4929:Psg16 UTSW 7 17095106 missense possibly damaging 0.79
R5310:Psg16 UTSW 7 17090635 missense probably damaging 0.99
R6106:Psg16 UTSW 7 17095166 missense possibly damaging 0.73
R6320:Psg16 UTSW 7 17088187 missense probably damaging 1.00
R6703:Psg16 UTSW 7 17090396 missense probably damaging 1.00
R7329:Psg16 UTSW 7 17090686 missense possibly damaging 0.86
R7679:Psg16 UTSW 7 17093760 missense probably damaging 1.00
R8292:Psg16 UTSW 7 17093776 missense probably damaging 0.99
R8372:Psg16 UTSW 7 17095315 missense probably benign 0.10
R8491:Psg16 UTSW 7 17090512 missense probably damaging 1.00
R8796:Psg16 UTSW 7 17093889 missense possibly damaging 0.90
R9131:Psg16 UTSW 7 17098099 missense probably benign 0.00
R9437:Psg16 UTSW 7 17093790 missense probably damaging 1.00
R9659:Psg16 UTSW 7 17090599 missense possibly damaging 0.55
R9746:Psg16 UTSW 7 17098161 missense probably benign 0.02
R9788:Psg16 UTSW 7 17090599 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CTGATCTCTGTAGAGGAGTGTG -3'
(R):5'- ACATTTGCCCCATCACACT -3'

Sequencing Primer
(F):5'- AACCACAGTTTCTGGTCAGG -3'
(R):5'- ATTTGCCCCATCACACTTACTTTAG -3'
Posted On 2018-07-24