Incidental Mutation 'R6702:Rab3a'
ID 528818
Institutional Source Beutler Lab
Gene Symbol Rab3a
Ensembl Gene ENSMUSG00000031840
Gene Name RAB3A, member RAS oncogene family
Synonyms
MMRRC Submission 044820-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.551) question?
Stock # R6702 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 71207328-71211323 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71209095 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000105720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034301] [ENSMUST00000038626] [ENSMUST00000110090] [ENSMUST00000110092] [ENSMUST00000110093] [ENSMUST00000143118]
AlphaFold P63011
Predicted Effect probably damaging
Transcript: ENSMUST00000034301
AA Change: D77G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034301
Gene: ENSMUSG00000031840
AA Change: D77G

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038626
SMART Domains Protein: ENSMUSP00000037929
Gene: ENSMUSG00000035559

DomainStartEndE-ValueType
Pfam:Mpv17_PMP22 122 187 6.7e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110090
AA Change: D77G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105717
Gene: ENSMUSG00000031840
AA Change: D77G

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110092
AA Change: D77G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105719
Gene: ENSMUSG00000031840
AA Change: D77G

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110093
AA Change: D77G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105720
Gene: ENSMUSG00000031840
AA Change: D77G

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130468
Predicted Effect probably benign
Transcript: ENSMUST00000143118
SMART Domains Protein: ENSMUSP00000123384
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
Pfam:Miro 1 43 2.5e-6 PFAM
Pfam:Ras 1 62 3.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212385
Predicted Effect probably benign
Transcript: ENSMUST00000212617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213010
Meta Mutation Damage Score 0.9749 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: Homozygous null mutants show impaired synaptic transmission, insulin secretion and glucose intolerance. This mutation and another chemically induced allele affect circadian period and sleep patterns. Heterozygotes show milder circadian rhythm anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,497,558 (GRCm39) Y66* probably null Het
Ak3 A G 19: 29,003,627 (GRCm39) V183A probably damaging Het
Ano10 G T 9: 122,088,630 (GRCm39) Q397K possibly damaging Het
Atg7 C A 6: 114,648,058 (GRCm39) probably null Het
Brpf3 A C 17: 29,029,633 (GRCm39) N531T probably benign Het
Casp2 T C 6: 42,244,985 (GRCm39) V128A probably benign Het
Cdcp2 T C 4: 106,964,283 (GRCm39) C378R probably benign Het
Cfap54 T A 10: 92,704,596 (GRCm39) D2828V unknown Het
Col6a3 T C 1: 90,707,161 (GRCm39) D1984G unknown Het
Csnk2a1 A G 2: 152,100,608 (GRCm39) T93A probably benign Het
Ddx54 T A 5: 120,764,568 (GRCm39) D758E possibly damaging Het
Dlx2 A G 2: 71,376,571 (GRCm39) S56P probably damaging Het
Dna2 T A 10: 62,809,073 (GRCm39) I1055N possibly damaging Het
Dnah10 A G 5: 124,882,869 (GRCm39) Y2909C probably damaging Het
Dnm3 A G 1: 162,146,256 (GRCm39) F296L probably benign Het
Fat1 A G 8: 45,406,083 (GRCm39) T945A probably benign Het
Herpud1 T C 8: 95,119,154 (GRCm39) probably null Het
Iqub T A 6: 24,449,744 (GRCm39) N707I probably damaging Het
Kif26b C G 1: 178,744,852 (GRCm39) S1649R possibly damaging Het
Lamp5 C G 2: 135,901,483 (GRCm39) N102K possibly damaging Het
Ltbr A G 6: 125,285,031 (GRCm39) S290P probably benign Het
Map4k1 T G 7: 28,701,821 (GRCm39) S803A possibly damaging Het
Mef2c T A 13: 83,773,525 (GRCm39) C134S possibly damaging Het
Myo15a A G 11: 60,383,818 (GRCm39) I1622V probably benign Het
Nbea A G 3: 55,912,923 (GRCm39) Y955H probably benign Het
Ndor1 A G 2: 25,139,902 (GRCm39) F142S possibly damaging Het
Nynrin A G 14: 56,101,935 (GRCm39) T535A possibly damaging Het
Or4k15 A G 14: 50,364,688 (GRCm39) Y218C probably damaging Het
Or4k42 T A 2: 111,320,454 (GRCm39) probably null Het
Or5ac23 C T 16: 59,148,961 (GRCm39) V304I probably benign Het
Or5d46 G A 2: 88,170,586 (GRCm39) V226I probably benign Het
Or8b51 A T 9: 38,569,073 (GRCm39) I205N possibly damaging Het
Pcdhb13 T G 18: 37,577,828 (GRCm39) H735Q probably benign Het
Pcdhb7 A T 18: 37,474,959 (GRCm39) M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Per2 C T 1: 91,355,671 (GRCm39) E696K probably damaging Het
Pld4 T C 12: 112,731,485 (GRCm39) S213P probably damaging Het
Prkg1 T A 19: 30,970,484 (GRCm39) H209L probably benign Het
Psg16 T C 7: 16,824,321 (GRCm39) L35P probably damaging Het
Pxn C T 5: 115,689,955 (GRCm39) L160F probably benign Het
Resf1 T A 6: 149,229,376 (GRCm39) N807K probably damaging Het
Rgma A T 7: 73,067,068 (GRCm39) T108S probably damaging Het
Rxrg A G 1: 167,441,374 (GRCm39) S51G probably benign Het
S1pr3 A T 13: 51,573,475 (GRCm39) I219F probably damaging Het
Sec23b A T 2: 144,401,109 (GRCm39) probably null Het
Sfrp5 G T 19: 42,190,266 (GRCm39) T62K probably benign Het
Slco1a6 T A 6: 142,048,826 (GRCm39) Y318F probably damaging Het
Slit1 A C 19: 41,603,309 (GRCm39) S931A possibly damaging Het
Sorl1 A T 9: 41,982,497 (GRCm39) V361E probably damaging Het
St6galnac2 A G 11: 116,575,213 (GRCm39) S209P probably benign Het
Supt6 C A 11: 78,122,626 (GRCm39) R199L possibly damaging Het
Tas2r107 A C 6: 131,636,347 (GRCm39) M234R probably benign Het
Tmem72 C G 6: 116,675,310 (GRCm39) V61L probably benign Het
Trpm5 C A 7: 142,623,055 (GRCm39) probably benign Het
Ttn T G 2: 76,550,456 (GRCm39) T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 (GRCm39) probably benign Het
Ubr3 A T 2: 69,786,393 (GRCm39) R836W probably benign Het
Umodl1 A G 17: 31,205,273 (GRCm39) probably null Het
Ythdf1 A G 2: 180,560,926 (GRCm39) probably null Het
Zfp780b T C 7: 27,671,066 (GRCm39) T81A possibly damaging Het
Zfp811 T C 17: 33,016,816 (GRCm39) E407G probably damaging Het
Other mutations in Rab3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1070:Rab3a UTSW 8 71,209,840 (GRCm39) missense probably damaging 1.00
R2196:Rab3a UTSW 8 71,209,872 (GRCm39) missense probably benign 0.00
R5315:Rab3a UTSW 8 71,208,569 (GRCm39) missense probably damaging 1.00
R6703:Rab3a UTSW 8 71,209,095 (GRCm39) missense probably damaging 1.00
R7422:Rab3a UTSW 8 71,209,170 (GRCm39) missense possibly damaging 0.87
R9330:Rab3a UTSW 8 71,209,881 (GRCm39) missense probably damaging 0.99
R9533:Rab3a UTSW 8 71,209,804 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCAGTACATGTTTGTTGAGTGAC -3'
(R):5'- GAACCCAAGGCTTTGTCCTG -3'

Sequencing Primer
(F):5'- ACTAAGTGGCCTTGCAGTGAC -3'
(R):5'- TTTGTCCTGGCCAAGCAG -3'
Posted On 2018-07-24