Incidental Mutation 'R6702:Olfr916'
ID 528820
Institutional Source Beutler Lab
Gene Symbol Olfr916
Ensembl Gene ENSMUSG00000094701
Gene Name olfactory receptor 916
Synonyms GA_x6K02T2PVTD-32360710-32359778, MOR168-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock # R6702 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 38655052-38659875 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38657777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 205 (I205N)
Ref Sequence ENSEMBL: ENSMUSP00000149578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081196] [ENSMUST00000213714] [ENSMUST00000214093] [ENSMUST00000215291]
AlphaFold Q8VG53
Predicted Effect possibly damaging
Transcript: ENSMUST00000081196
AA Change: I205N

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079959
Gene: ENSMUSG00000094701
AA Change: I205N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-45 PFAM
Pfam:7tm_1 41 290 1.3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213714
AA Change: I205N

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214093
AA Change: I205N

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000215291
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
2810474O19Rik T A 6: 149,327,878 N807K probably damaging Het
Ak3 A G 19: 29,026,227 V183A probably damaging Het
Ano10 G T 9: 122,259,564 Q397K possibly damaging Het
Atg7 C A 6: 114,671,097 probably null Het
Brpf3 A C 17: 28,810,659 N531T probably benign Het
Casp2 T C 6: 42,268,051 V128A probably benign Het
Cdcp2 T C 4: 107,107,086 C378R probably benign Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Ddx54 T A 5: 120,626,503 D758E possibly damaging Het
Dlx2 A G 2: 71,546,227 S56P probably damaging Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnah10 A G 5: 124,805,805 Y2909C probably damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Herpud1 T C 8: 94,392,526 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kif26b C G 1: 178,917,287 S1649R possibly damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Ltbr A G 6: 125,308,068 S290P probably benign Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Nbea A G 3: 56,005,502 Y955H probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1176 G A 2: 88,340,242 V226I probably benign Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Pcdhb13 T G 18: 37,444,775 H735Q probably benign Het
Pcdhb7 A T 18: 37,341,906 M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pld4 T C 12: 112,765,051 S213P probably damaging Het
Prkg1 T A 19: 30,993,084 H209L probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Pxn C T 5: 115,551,896 L160F probably benign Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rgma A T 7: 73,417,320 T108S probably damaging Het
Rxrg A G 1: 167,613,805 S51G probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Sfrp5 G T 19: 42,201,827 T62K probably benign Het
Slco1a6 T A 6: 142,103,100 Y318F probably damaging Het
Slit1 A C 19: 41,614,870 S931A possibly damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Supt6 C A 11: 78,231,800 R199L possibly damaging Het
Tas2r107 A C 6: 131,659,384 M234R probably benign Het
Tmem72 C G 6: 116,698,349 V61L probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Ttn T G 2: 76,720,112 T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubr3 A T 2: 69,956,049 R836W probably benign Het
Umodl1 A G 17: 30,986,299 probably null Het
Ythdf1 A G 2: 180,919,133 probably null Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Zfp811 T C 17: 32,797,842 E407G probably damaging Het
Other mutations in Olfr916
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Olfr916 APN 9 38657622 missense probably benign 0.00
IGL02313:Olfr916 APN 9 38658066 missense probably damaging 0.97
IGL03221:Olfr916 APN 9 38658365 missense probably damaging 0.99
R0479:Olfr916 UTSW 9 38658182 missense probably damaging 1.00
R1507:Olfr916 UTSW 9 38658014 missense probably damaging 1.00
R1521:Olfr916 UTSW 9 38657718 missense probably damaging 0.99
R1860:Olfr916 UTSW 9 38658365 missense probably damaging 0.99
R3107:Olfr916 UTSW 9 38658011 missense possibly damaging 0.48
R3964:Olfr916 UTSW 9 38657727 missense probably benign 0.42
R3965:Olfr916 UTSW 9 38657727 missense probably benign 0.42
R4419:Olfr916 UTSW 9 38658069 missense probably benign 0.01
R5249:Olfr916 UTSW 9 38658078 missense possibly damaging 0.88
R5481:Olfr916 UTSW 9 38657620 missense probably benign 0.00
R6299:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6555:Olfr916 UTSW 9 38658289 missense probably benign 0.00
R6703:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6851:Olfr916 UTSW 9 38658185 missense probably benign 0.31
R6895:Olfr916 UTSW 9 38658089 missense probably damaging 0.97
R8688:Olfr916 UTSW 9 38657751 missense probably benign 0.24
R8985:Olfr916 UTSW 9 38658325 nonsense probably null
R9259:Olfr916 UTSW 9 38658346 splice site probably benign
R9292:Olfr916 UTSW 9 38657775 missense probably damaging 1.00
R9634:Olfr916 UTSW 9 38657573 missense probably benign 0.06
R9641:Olfr916 UTSW 9 38657619 missense probably benign 0.00
R9772:Olfr916 UTSW 9 38657668 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACTCAGCTGAGGATGGTTG -3'
(R):5'- ACCACTGCTGTATAATCTTGTCATG -3'

Sequencing Primer
(F):5'- GGTTGGAAATACATAAATGCACCTG -3'
(R):5'- ATGTTTGAACCTAATGCTTGTTTCC -3'
Posted On 2018-07-24