Incidental Mutation 'R6702:Sorl1'
ID 528821
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms Sorla, mSorLA, LR11, 2900010L19Rik
MMRRC Submission 044820-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R6702 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 41876016-42035593 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41982497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 361 (V361E)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: V361E

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: V361E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,497,558 (GRCm39) Y66* probably null Het
Ak3 A G 19: 29,003,627 (GRCm39) V183A probably damaging Het
Ano10 G T 9: 122,088,630 (GRCm39) Q397K possibly damaging Het
Atg7 C A 6: 114,648,058 (GRCm39) probably null Het
Brpf3 A C 17: 29,029,633 (GRCm39) N531T probably benign Het
Casp2 T C 6: 42,244,985 (GRCm39) V128A probably benign Het
Cdcp2 T C 4: 106,964,283 (GRCm39) C378R probably benign Het
Cfap54 T A 10: 92,704,596 (GRCm39) D2828V unknown Het
Col6a3 T C 1: 90,707,161 (GRCm39) D1984G unknown Het
Csnk2a1 A G 2: 152,100,608 (GRCm39) T93A probably benign Het
Ddx54 T A 5: 120,764,568 (GRCm39) D758E possibly damaging Het
Dlx2 A G 2: 71,376,571 (GRCm39) S56P probably damaging Het
Dna2 T A 10: 62,809,073 (GRCm39) I1055N possibly damaging Het
Dnah10 A G 5: 124,882,869 (GRCm39) Y2909C probably damaging Het
Dnm3 A G 1: 162,146,256 (GRCm39) F296L probably benign Het
Fat1 A G 8: 45,406,083 (GRCm39) T945A probably benign Het
Herpud1 T C 8: 95,119,154 (GRCm39) probably null Het
Iqub T A 6: 24,449,744 (GRCm39) N707I probably damaging Het
Kif26b C G 1: 178,744,852 (GRCm39) S1649R possibly damaging Het
Lamp5 C G 2: 135,901,483 (GRCm39) N102K possibly damaging Het
Ltbr A G 6: 125,285,031 (GRCm39) S290P probably benign Het
Map4k1 T G 7: 28,701,821 (GRCm39) S803A possibly damaging Het
Mef2c T A 13: 83,773,525 (GRCm39) C134S possibly damaging Het
Myo15a A G 11: 60,383,818 (GRCm39) I1622V probably benign Het
Nbea A G 3: 55,912,923 (GRCm39) Y955H probably benign Het
Ndor1 A G 2: 25,139,902 (GRCm39) F142S possibly damaging Het
Nynrin A G 14: 56,101,935 (GRCm39) T535A possibly damaging Het
Or4k15 A G 14: 50,364,688 (GRCm39) Y218C probably damaging Het
Or4k42 T A 2: 111,320,454 (GRCm39) probably null Het
Or5ac23 C T 16: 59,148,961 (GRCm39) V304I probably benign Het
Or5d46 G A 2: 88,170,586 (GRCm39) V226I probably benign Het
Or8b51 A T 9: 38,569,073 (GRCm39) I205N possibly damaging Het
Pcdhb13 T G 18: 37,577,828 (GRCm39) H735Q probably benign Het
Pcdhb7 A T 18: 37,474,959 (GRCm39) M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Per2 C T 1: 91,355,671 (GRCm39) E696K probably damaging Het
Pld4 T C 12: 112,731,485 (GRCm39) S213P probably damaging Het
Prkg1 T A 19: 30,970,484 (GRCm39) H209L probably benign Het
Psg16 T C 7: 16,824,321 (GRCm39) L35P probably damaging Het
Pxn C T 5: 115,689,955 (GRCm39) L160F probably benign Het
Rab3a A G 8: 71,209,095 (GRCm39) D77G probably damaging Het
Resf1 T A 6: 149,229,376 (GRCm39) N807K probably damaging Het
Rgma A T 7: 73,067,068 (GRCm39) T108S probably damaging Het
Rxrg A G 1: 167,441,374 (GRCm39) S51G probably benign Het
S1pr3 A T 13: 51,573,475 (GRCm39) I219F probably damaging Het
Sec23b A T 2: 144,401,109 (GRCm39) probably null Het
Sfrp5 G T 19: 42,190,266 (GRCm39) T62K probably benign Het
Slco1a6 T A 6: 142,048,826 (GRCm39) Y318F probably damaging Het
Slit1 A C 19: 41,603,309 (GRCm39) S931A possibly damaging Het
St6galnac2 A G 11: 116,575,213 (GRCm39) S209P probably benign Het
Supt6 C A 11: 78,122,626 (GRCm39) R199L possibly damaging Het
Tas2r107 A C 6: 131,636,347 (GRCm39) M234R probably benign Het
Tmem72 C G 6: 116,675,310 (GRCm39) V61L probably benign Het
Trpm5 C A 7: 142,623,055 (GRCm39) probably benign Het
Ttn T G 2: 76,550,456 (GRCm39) T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 (GRCm39) probably benign Het
Ubr3 A T 2: 69,786,393 (GRCm39) R836W probably benign Het
Umodl1 A G 17: 31,205,273 (GRCm39) probably null Het
Ythdf1 A G 2: 180,560,926 (GRCm39) probably null Het
Zfp780b T C 7: 27,671,066 (GRCm39) T81A possibly damaging Het
Zfp811 T C 17: 33,016,816 (GRCm39) E407G probably damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41,885,390 (GRCm39) missense probably damaging 1.00
IGL01303:Sorl1 APN 9 41,935,774 (GRCm39) splice site probably benign
IGL01545:Sorl1 APN 9 41,955,252 (GRCm39) missense probably damaging 1.00
IGL01629:Sorl1 APN 9 41,968,565 (GRCm39) critical splice donor site probably null
IGL01670:Sorl1 APN 9 41,912,788 (GRCm39) missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41,892,007 (GRCm39) missense probably damaging 0.96
IGL02154:Sorl1 APN 9 41,915,330 (GRCm39) missense probably benign
IGL02215:Sorl1 APN 9 41,929,478 (GRCm39) missense probably damaging 0.97
IGL02427:Sorl1 APN 9 41,952,986 (GRCm39) missense probably damaging 1.00
IGL02590:Sorl1 APN 9 41,957,857 (GRCm39) missense probably benign 0.01
IGL02794:Sorl1 APN 9 41,975,070 (GRCm39) missense probably damaging 0.98
IGL02797:Sorl1 APN 9 41,948,355 (GRCm39) missense probably damaging 0.99
IGL02987:Sorl1 APN 9 41,952,349 (GRCm39) missense probably damaging 1.00
IGL03005:Sorl1 APN 9 41,968,621 (GRCm39) missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41,902,722 (GRCm39) missense probably benign
IGL03288:Sorl1 APN 9 41,944,858 (GRCm39) splice site probably benign
N/A - 287:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
PIT4151001:Sorl1 UTSW 9 41,879,918 (GRCm39) missense probably damaging 1.00
R0117:Sorl1 UTSW 9 41,944,873 (GRCm39) missense probably benign 0.10
R0173:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R0318:Sorl1 UTSW 9 41,993,250 (GRCm39) missense probably damaging 1.00
R0385:Sorl1 UTSW 9 41,943,205 (GRCm39) missense probably damaging 0.99
R0448:Sorl1 UTSW 9 41,915,384 (GRCm39) missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41,902,667 (GRCm39) missense probably null 0.00
R0512:Sorl1 UTSW 9 41,979,128 (GRCm39) missense probably benign 0.01
R0587:Sorl1 UTSW 9 41,895,802 (GRCm39) missense probably damaging 1.00
R0600:Sorl1 UTSW 9 41,955,196 (GRCm39) splice site probably benign
R0831:Sorl1 UTSW 9 41,982,365 (GRCm39) splice site probably benign
R0924:Sorl1 UTSW 9 41,919,470 (GRCm39) splice site probably benign
R1013:Sorl1 UTSW 9 41,913,855 (GRCm39) missense probably benign 0.00
R1053:Sorl1 UTSW 9 41,902,752 (GRCm39) missense probably benign
R1077:Sorl1 UTSW 9 41,925,786 (GRCm39) missense probably damaging 1.00
R1326:Sorl1 UTSW 9 41,943,092 (GRCm39) missense probably benign 0.14
R1348:Sorl1 UTSW 9 41,911,708 (GRCm39) splice site probably null
R1498:Sorl1 UTSW 9 41,952,369 (GRCm39) missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41,885,296 (GRCm39) missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41,907,538 (GRCm39) missense probably benign 0.06
R1738:Sorl1 UTSW 9 42,001,261 (GRCm39) missense probably benign 0.33
R1779:Sorl1 UTSW 9 41,902,778 (GRCm39) critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41,881,021 (GRCm39) nonsense probably null
R1912:Sorl1 UTSW 9 41,993,246 (GRCm39) missense probably damaging 1.00
R1952:Sorl1 UTSW 9 41,957,920 (GRCm39) missense probably benign
R2071:Sorl1 UTSW 9 41,890,753 (GRCm39) missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41,895,788 (GRCm39) missense probably benign 0.01
R2417:Sorl1 UTSW 9 41,892,007 (GRCm39) missense probably damaging 0.96
R2429:Sorl1 UTSW 9 41,948,366 (GRCm39) missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41,881,077 (GRCm39) missense probably benign
R3815:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 41,915,401 (GRCm39) missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41,900,764 (GRCm39) critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 41,946,744 (GRCm39) missense probably damaging 0.99
R4410:Sorl1 UTSW 9 41,915,288 (GRCm39) nonsense probably null
R4610:Sorl1 UTSW 9 41,943,210 (GRCm39) missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4666:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41,895,804 (GRCm39) missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41,903,617 (GRCm39) missense probably damaging 1.00
R4874:Sorl1 UTSW 9 41,975,048 (GRCm39) missense probably damaging 0.99
R4898:Sorl1 UTSW 9 41,952,935 (GRCm39) missense probably damaging 1.00
R4922:Sorl1 UTSW 9 41,925,746 (GRCm39) splice site probably null
R4976:Sorl1 UTSW 9 41,894,299 (GRCm39) missense probably benign 0.00
R4984:Sorl1 UTSW 9 41,902,638 (GRCm39) missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R5070:Sorl1 UTSW 9 41,943,114 (GRCm39) missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41,887,673 (GRCm39) missense probably benign 0.01
R5202:Sorl1 UTSW 9 41,944,879 (GRCm39) missense probably benign 0.00
R5265:Sorl1 UTSW 9 42,017,812 (GRCm39) missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 41,942,198 (GRCm39) missense probably benign 0.33
R5368:Sorl1 UTSW 9 41,890,686 (GRCm39) missense probably benign 0.00
R5385:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 41,913,932 (GRCm39) nonsense probably null
R5518:Sorl1 UTSW 9 41,948,508 (GRCm39) missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41,902,921 (GRCm39) missense probably benign 0.08
R5864:Sorl1 UTSW 9 42,003,669 (GRCm39) missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41,894,330 (GRCm39) missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41,881,038 (GRCm39) missense probably benign 0.10
R6484:Sorl1 UTSW 9 41,887,703 (GRCm39) missense probably damaging 1.00
R6505:Sorl1 UTSW 9 41,982,530 (GRCm39) missense probably damaging 1.00
R6591:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6596:Sorl1 UTSW 9 41,912,899 (GRCm39) missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41,891,941 (GRCm39) missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6703:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42,003,748 (GRCm39) missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42,010,559 (GRCm39) missense probably damaging 1.00
R6852:Sorl1 UTSW 9 41,935,694 (GRCm39) missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 41,933,688 (GRCm39) missense probably benign 0.01
R6925:Sorl1 UTSW 9 41,944,922 (GRCm39) missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41,881,047 (GRCm39) missense probably benign 0.11
R7033:Sorl1 UTSW 9 41,942,279 (GRCm39) missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 41,913,930 (GRCm39) missense probably benign 0.00
R7267:Sorl1 UTSW 9 42,035,375 (GRCm39) missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 41,948,499 (GRCm39) missense probably damaging 0.99
R7272:Sorl1 UTSW 9 41,975,006 (GRCm39) splice site probably null
R7537:Sorl1 UTSW 9 41,891,984 (GRCm39) missense probably benign 0.01
R7615:Sorl1 UTSW 9 41,888,878 (GRCm39) missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42,003,630 (GRCm39) missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41,895,822 (GRCm39) missense probably damaging 1.00
R7763:Sorl1 UTSW 9 41,955,205 (GRCm39) missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42,001,257 (GRCm39) missense probably benign 0.17
R7956:Sorl1 UTSW 9 41,900,655 (GRCm39) missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41,902,697 (GRCm39) missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R8151:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R8219:Sorl1 UTSW 9 41,952,857 (GRCm39) splice site probably null
R8261:Sorl1 UTSW 9 41,925,777 (GRCm39) missense probably damaging 1.00
R8283:Sorl1 UTSW 9 41,942,294 (GRCm39) missense probably damaging 1.00
R8308:Sorl1 UTSW 9 41,929,456 (GRCm39) missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8448:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8524:Sorl1 UTSW 9 41,885,370 (GRCm39) missense probably damaging 1.00
R8869:Sorl1 UTSW 9 41,933,722 (GRCm39) missense probably benign 0.01
R8898:Sorl1 UTSW 9 41,911,567 (GRCm39) missense probably damaging 1.00
R8972:Sorl1 UTSW 9 41,957,848 (GRCm39) missense probably damaging 1.00
R9012:Sorl1 UTSW 9 41,982,491 (GRCm39) missense probably damaging 1.00
R9094:Sorl1 UTSW 9 41,975,050 (GRCm39) missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41,885,420 (GRCm39) nonsense probably null
R9278:Sorl1 UTSW 9 41,957,857 (GRCm39) missense probably benign 0.01
R9288:Sorl1 UTSW 9 41,952,927 (GRCm39) missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41,900,739 (GRCm39) missense probably damaging 1.00
R9330:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 1.00
R9332:Sorl1 UTSW 9 41,912,814 (GRCm39) missense probably damaging 1.00
R9468:Sorl1 UTSW 9 42,035,384 (GRCm39) missense probably benign 0.20
R9528:Sorl1 UTSW 9 41,933,631 (GRCm39) critical splice donor site probably null
R9544:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9563:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9564:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9588:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9634:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R9671:Sorl1 UTSW 9 41,943,077 (GRCm39) missense possibly damaging 0.85
R9701:Sorl1 UTSW 9 42,003,766 (GRCm39) missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42,035,244 (GRCm39) missense probably benign 0.03
Z1176:Sorl1 UTSW 9 42,010,499 (GRCm39) missense possibly damaging 0.64
Z1177:Sorl1 UTSW 9 42,017,837 (GRCm39) missense probably benign 0.00
Z1177:Sorl1 UTSW 9 41,902,934 (GRCm39) missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42,035,208 (GRCm39) missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCCCATGGACAACTAATC -3'
(R):5'- AGCTATGTCAGTTTGCAGGG -3'

Sequencing Primer
(F):5'- TAAGAAGAGTCTGGTGGCCTG -3'
(R):5'- CTATGTCAGTTTGCAGGGGGAGG -3'
Posted On 2018-07-24