Mutagenetix > Incidental Mutation

Incidental Mutation 'R6702:Myo15'

528826

Institutional Source

Beutler Lab

Gene Symbol

Myo15

Ensembl Gene

ENSMUSG00000042678

Gene Name

myosin XV

Synonyms

sh2; sh-2; Myo15a

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6702 (G1)

Quality Score

191.009

Status

Validated

Chromosome

Chromosomal Location

60469339-60528369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60492992 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1622 (I1622V)

Ref Sequence

ENSEMBL: ENSMUSP00000091686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000071880
AA Change: I1622V

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: I1622V

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	87	100	N/A	INTRINSIC
low complexity region	107	120	N/A	INTRINSIC
low complexity region	269	292	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
low complexity region	311	325	N/A	INTRINSIC
low complexity region	349	384	N/A	INTRINSIC
low complexity region	425	435	N/A	INTRINSIC
low complexity region	487	498	N/A	INTRINSIC
low complexity region	502	509	N/A	INTRINSIC
low complexity region	653	681	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	758	775	N/A	INTRINSIC
low complexity region	781	792	N/A	INTRINSIC
low complexity region	796	809	N/A	INTRINSIC
low complexity region	825	849	N/A	INTRINSIC
low complexity region	883	897	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
low complexity region	1115	1130	N/A	INTRINSIC
MYSc	1200	1884	N/A	SMART
IQ	1885	1907	1.63e-1	SMART
IQ	1908	1930	1.77e-2	SMART
IQ	1931	1953	2.97e2	SMART
low complexity region	1955	1974	N/A	INTRINSIC
low complexity region	1992	2006	N/A	INTRINSIC
MyTH4	2049	2195	1.8e-42	SMART
low complexity region	2396	2405	N/A	INTRINSIC
low complexity region	2451	2461	N/A	INTRINSIC
Blast:MYSc	2665	2848	2e-14	BLAST
SH3	2851	2933	1.55e-4	SMART
low complexity region	2949	2962	N/A	INTRINSIC
MyTH4	3031	3185	5.59e-48	SMART
B41	3188	3400	6.94e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000081823
AA Change: I435V

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: I435V

Domain	Start	End	E-Value	Type
MYSc	13	697	N/A	SMART
IQ	698	720	1.63e-1	SMART
IQ	721	743	1.77e-2	SMART
IQ	744	766	2.97e2	SMART
low complexity region	787	801	N/A	INTRINSIC
MyTH4	844	990	1.8e-42	SMART
low complexity region	1191	1200	N/A	INTRINSIC
low complexity region	1246	1256	N/A	INTRINSIC
Blast:MYSc	1460	1643	7e-15	BLAST
SH3	1646	1728	1.55e-4	SMART
low complexity region	1744	1757	N/A	INTRINSIC
MyTH4	1826	1980	5.59e-48	SMART
B41	1983	2195	6.94e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094135
AA Change: I1622V

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: I1622V

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	87	100	N/A	INTRINSIC
low complexity region	107	120	N/A	INTRINSIC
low complexity region	269	292	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
low complexity region	311	325	N/A	INTRINSIC
low complexity region	349	384	N/A	INTRINSIC
low complexity region	425	435	N/A	INTRINSIC
low complexity region	487	498	N/A	INTRINSIC
low complexity region	502	509	N/A	INTRINSIC
low complexity region	653	681	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	758	775	N/A	INTRINSIC
low complexity region	781	792	N/A	INTRINSIC
low complexity region	796	809	N/A	INTRINSIC
low complexity region	825	849	N/A	INTRINSIC
low complexity region	883	897	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
low complexity region	1115	1130	N/A	INTRINSIC
MYSc	1200	1884	N/A	SMART
IQ	1885	1907	1.63e-1	SMART
IQ	1908	1930	1.77e-2	SMART
IQ	1931	1953	2.97e2	SMART
low complexity region	1974	1988	N/A	INTRINSIC
MyTH4	2031	2177	1.8e-42	SMART
low complexity region	2378	2387	N/A	INTRINSIC
low complexity region	2433	2443	N/A	INTRINSIC
Blast:MYSc	2647	2830	2e-14	BLAST
SH3	2833	2915	1.55e-4	SMART
low complexity region	2931	2944	N/A	INTRINSIC
MyTH4	3013	3167	5.59e-48	SMART
B41	3170	3382	6.94e-3	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000126522
AA Change: I453V

SMART Domains

Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: I453V

Domain	Start	End	E-Value	Type
MYSc	34	716	N/A	SMART
IQ	717	739	1.63e-1	SMART
IQ	740	762	1.77e-2	SMART
IQ	763	785	2.97e2	SMART
low complexity region	806	820	N/A	INTRINSIC
MyTH4	863	1009	1.8e-42	SMART
low complexity region	1210	1219	N/A	INTRINSIC
low complexity region	1265	1275	N/A	INTRINSIC
Blast:MYSc	1479	1662	5e-15	BLAST
SH3	1665	1747	1.55e-4	SMART
low complexity region	1763	1776	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	T	A	10: 21,621,659	Y66*	probably null	Het
2810474O19Rik	T	A	6: 149,327,878	N807K	probably damaging	Het
Ak3	A	G	19: 29,026,227	V183A	probably damaging	Het
Ano10	G	T	9: 122,259,564	Q397K	possibly damaging	Het
Atg7	C	A	6: 114,671,097		probably null	Het
Brpf3	A	C	17: 28,810,659	N531T	probably benign	Het
Casp2	T	C	6: 42,268,051	V128A	probably benign	Het
Cdcp2	T	C	4: 107,107,086	C378R	probably benign	Het
Cfap54	T	A	10: 92,868,734	D2828V	unknown	Het
Col6a3	T	C	1: 90,779,439	D1984G	unknown	Het
Csnk2a1	A	G	2: 152,258,688	T93A	probably benign	Het
Ddx54	T	A	5: 120,626,503	D758E	possibly damaging	Het
Dlx2	A	G	2: 71,546,227	S56P	probably damaging	Het
Dna2	T	A	10: 62,973,294	I1055N	possibly damaging	Het
Dnah10	A	G	5: 124,805,805	Y2909C	probably damaging	Het
Dnm3	A	G	1: 162,318,687	F296L	probably benign	Het
Fat1	A	G	8: 44,953,046	T945A	probably benign	Het
Herpud1	T	C	8: 94,392,526		probably null	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Kif26b	C	G	1: 178,917,287	S1649R	possibly damaging	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Ltbr	A	G	6: 125,308,068	S290P	probably benign	Het
Map4k1	T	G	7: 29,002,396	S803A	possibly damaging	Het
Mef2c	T	A	13: 83,625,406	C134S	possibly damaging	Het
Nbea	A	G	3: 56,005,502	Y955H	probably benign	Het
Ndor1	A	G	2: 25,249,890	F142S	possibly damaging	Het
Nynrin	A	G	14: 55,864,478	T535A	possibly damaging	Het
Olfr1176	G	A	2: 88,340,242	V226I	probably benign	Het
Olfr1290	T	A	2: 111,490,109		probably null	Het
Olfr205	C	T	16: 59,328,598	V304I	probably benign	Het
Olfr727	A	G	14: 50,127,231	Y218C	probably damaging	Het
Olfr916	A	T	9: 38,657,777	I205N	possibly damaging	Het
Pcdhb13	T	G	18: 37,444,775	H735Q	probably benign	Het
Pcdhb7	A	T	18: 37,341,906	M32L	probably benign	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Per2	C	T	1: 91,427,949	E696K	probably damaging	Het
Pld4	T	C	12: 112,765,051	S213P	probably damaging	Het
Prkg1	T	A	19: 30,993,084	H209L	probably benign	Het
Psg16	T	C	7: 17,090,396	L35P	probably damaging	Het
Pxn	C	T	5: 115,551,896	L160F	probably benign	Het
Rab3a	A	G	8: 70,756,448	D77G	probably damaging	Het
Rgma	A	T	7: 73,417,320	T108S	probably damaging	Het
Rxrg	A	G	1: 167,613,805	S51G	probably benign	Het
S1pr3	A	T	13: 51,419,439	I219F	probably damaging	Het
Sec23b	A	T	2: 144,559,189		probably null	Het
Sfrp5	G	T	19: 42,201,827	T62K	probably benign	Het
Slco1a6	T	A	6: 142,103,100	Y318F	probably damaging	Het
Slit1	A	C	19: 41,614,870	S931A	possibly damaging	Het
Sorl1	A	T	9: 42,071,201	V361E	probably damaging	Het
St6galnac2	A	G	11: 116,684,387	S209P	probably benign	Het
Supt6	C	A	11: 78,231,800	R199L	possibly damaging	Het
Tas2r107	A	C	6: 131,659,384	M234R	probably benign	Het
Tmem72	C	G	6: 116,698,349	V61L	probably benign	Het
Trpm5	C	A	7: 143,069,318		probably benign	Het
Ttn	T	G	2: 76,720,112	T23282P	probably damaging	Het
Ubap2	GCCCGCTTGCCCCGCT	GCCCGCTTGCCCCGCTTGCCCCGCT	4: 41,227,210		probably benign	Het
Ubr3	A	T	2: 69,956,049	R836W	probably benign	Het
Umodl1	A	G	17: 30,986,299		probably null	Het
Ythdf1	A	G	2: 180,919,133		probably null	Het
Zfp780b	T	C	7: 27,971,641	T81A	possibly damaging	Het
Zfp811	T	C	17: 32,797,842	E407G	probably damaging	Het

Other mutations in Myo15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00845:Myo15	APN	11	60477779	missense	probably damaging	1.00
IGL01011:Myo15	APN	11	60476992	missense	probably benign	0.33
IGL01100:Myo15	APN	11	60511158	missense	probably damaging	1.00
IGL01357:Myo15	APN	11	60502289	splice site	probably benign
IGL01634:Myo15	APN	11	60495472	missense	probably damaging	1.00
IGL01763:Myo15	APN	11	60521738	missense	probably benign	0.07
IGL01901:Myo15	APN	11	60527434	utr 3 prime	probably benign
IGL01931:Myo15	APN	11	60496138	missense	probably damaging	1.00
IGL02006:Myo15	APN	11	60511128	missense	probably damaging	1.00
IGL02041:Myo15	APN	11	60506863	missense	probably damaging	0.99
IGL02094:Myo15	APN	11	60510647	unclassified	probably benign
IGL02122:Myo15	APN	11	60483466	missense	probably benign	0.23
IGL02153:Myo15	APN	11	60498397	missense	probably damaging	1.00
IGL02328:Myo15	APN	11	60526607	missense	probably benign	0.13
IGL02330:Myo15	APN	11	60477161	missense	possibly damaging	0.94
IGL02431:Myo15	APN	11	60510639	missense	possibly damaging	0.73
IGL02639:Myo15	APN	11	60478621	missense	probably benign
IGL02659:Myo15	APN	11	60491783	splice site	probably benign
IGL02800:Myo15	APN	11	60502369	missense	probably damaging	1.00
IGL02812:Myo15	APN	11	60477179	missense	probably benign	0.15
IGL02863:Myo15	APN	11	60478127	missense	probably damaging	1.00
IGL02873:Myo15	APN	11	60483482	missense	probably damaging	1.00
IGL02990:Myo15	APN	11	60479440	missense	probably benign	0.02
IGL03011:Myo15	APN	11	60509531	splice site	probably benign
IGL03243:Myo15	APN	11	60496518	missense	probably damaging	1.00
IGL03297:Myo15	APN	11	60479141	missense	probably damaging	1.00
parker	UTSW	11	60520914	critical splice donor site	probably null
Typhoon	UTSW	11	60487425	critical splice donor site	probably null
PIT4131001:Myo15	UTSW	11	60483127	missense	probably damaging	1.00
PIT4131001:Myo15	UTSW	11	60495454	missense	probably damaging	1.00
R0133:Myo15	UTSW	11	60477850	missense	possibly damaging	0.94
R0265:Myo15	UTSW	11	60514897	critical splice acceptor site	probably null
R0389:Myo15	UTSW	11	60478538	missense	probably benign
R0416:Myo15	UTSW	11	60511174	missense	probably damaging	1.00
R0449:Myo15	UTSW	11	60509596	missense	possibly damaging	0.92
R0477:Myo15	UTSW	11	60520914	critical splice donor site	probably null
R0543:Myo15	UTSW	11	60479051	missense	probably benign
R0546:Myo15	UTSW	11	60506313	missense	probably damaging	1.00
R0555:Myo15	UTSW	11	60521638	missense	probably damaging	1.00
R0639:Myo15	UTSW	11	60479336	missense	probably benign	0.12
R0723:Myo15	UTSW	11	60478977	missense	possibly damaging	0.94
R0837:Myo15	UTSW	11	60487251	missense	probably damaging	0.98
R0865:Myo15	UTSW	11	60491688	missense	probably damaging	1.00
R0899:Myo15	UTSW	11	60477185	missense	possibly damaging	0.87
R1022:Myo15	UTSW	11	60479616	missense	probably benign	0.00
R1024:Myo15	UTSW	11	60479616	missense	probably benign	0.00
R1035:Myo15	UTSW	11	60510558	unclassified	probably benign
R1109:Myo15	UTSW	11	60493066	missense	probably damaging	1.00
R1170:Myo15	UTSW	11	60479407	missense	probably benign	0.04
R1241:Myo15	UTSW	11	60499430	missense	possibly damaging	0.58
R1392:Myo15	UTSW	11	60477974	missense	possibly damaging	0.95
R1392:Myo15	UTSW	11	60477974	missense	possibly damaging	0.95
R1434:Myo15	UTSW	11	60504331	missense	probably benign	0.00
R1450:Myo15	UTSW	11	60495482	missense	probably damaging	1.00
R1456:Myo15	UTSW	11	60508202	missense	probably damaging	1.00
R1468:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R1468:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R1548:Myo15	UTSW	11	60488238	missense	probably damaging	1.00
R1551:Myo15	UTSW	11	60492965	missense	possibly damaging	0.70
R1571:Myo15	UTSW	11	60518464	missense	probably damaging	1.00
R1662:Myo15	UTSW	11	60501701	missense	probably damaging	1.00
R1777:Myo15	UTSW	11	60514936	missense	probably benign
R1778:Myo15	UTSW	11	60478412	missense	possibly damaging	0.57
R1847:Myo15	UTSW	11	60499495	nonsense	probably null
R1875:Myo15	UTSW	11	60507528	missense	probably damaging	0.99
R1944:Myo15	UTSW	11	60502083	missense	probably damaging	0.99
R1945:Myo15	UTSW	11	60502083	missense	probably damaging	0.99
R2013:Myo15	UTSW	11	60494231	missense	probably damaging	1.00
R2107:Myo15	UTSW	11	60491810	missense	probably damaging	1.00
R2108:Myo15	UTSW	11	60491810	missense	probably damaging	1.00
R2112:Myo15	UTSW	11	60494168	missense	probably damaging	0.99
R2147:Myo15	UTSW	11	60510229	missense	possibly damaging	0.66
R2196:Myo15	UTSW	11	60510021	nonsense	probably null
R2207:Myo15	UTSW	11	60506034	missense	probably benign	0.01
R2245:Myo15	UTSW	11	60509099	missense	probably damaging	1.00
R2367:Myo15	UTSW	11	60517238	missense	probably damaging	0.99
R2374:Myo15	UTSW	11	60478843	missense	possibly damaging	0.88
R2438:Myo15	UTSW	11	60483052	missense	probably damaging	1.00
R3154:Myo15	UTSW	11	60479360	splice site	probably null
R3423:Myo15	UTSW	11	60510300	critical splice donor site	probably null
R3551:Myo15	UTSW	11	60509663	missense	possibly damaging	0.93
R3552:Myo15	UTSW	11	60509663	missense	possibly damaging	0.93
R3612:Myo15	UTSW	11	60477679	missense	probably damaging	1.00
R3620:Myo15	UTSW	11	60478642	missense	possibly damaging	0.63
R3713:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3714:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3715:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3783:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3784:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3785:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3786:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3787:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3894:Myo15	UTSW	11	60504319	missense	probably benign	0.00
R3962:Myo15	UTSW	11	60479828	missense	probably benign	0.00
R4082:Myo15	UTSW	11	60487196	missense	possibly damaging	0.92
R4555:Myo15	UTSW	11	60496937	missense	probably damaging	1.00
R4641:Myo15	UTSW	11	60503041	missense	probably damaging	1.00
R4665:Myo15	UTSW	11	60504879	critical splice acceptor site	probably null
R4713:Myo15	UTSW	11	60479930	missense	probably benign	0.21
R4820:Myo15	UTSW	11	60476915	missense	probably damaging	0.98
R5013:Myo15	UTSW	11	60491667	missense	probably damaging	1.00
R5051:Myo15	UTSW	11	60487425	critical splice donor site	probably null
R5187:Myo15	UTSW	11	60503614	missense	probably damaging	1.00
R5230:Myo15	UTSW	11	60502848	missense	possibly damaging	0.68
R5277:Myo15	UTSW	11	60477114	nonsense	probably null
R5345:Myo15	UTSW	11	60497538	missense	probably damaging	0.99
R5349:Myo15	UTSW	11	60493583	missense	probably damaging	1.00
R5356:Myo15	UTSW	11	60498366	missense	probably damaging	1.00
R5445:Myo15	UTSW	11	60520777	nonsense	probably null
R5477:Myo15	UTSW	11	60477677	missense	probably damaging	1.00
R5629:Myo15	UTSW	11	60479752	missense	probably benign
R5728:Myo15	UTSW	11	60488896	missense	probably damaging	1.00
R5818:Myo15	UTSW	11	60497951	missense	probably benign	0.06
R5952:Myo15	UTSW	11	60479420	missense	possibly damaging	0.50
R6338:Myo15	UTSW	11	60478133	missense	probably damaging	0.99
R6467:Myo15	UTSW	11	60526661	critical splice donor site	probably null
R6488:Myo15	UTSW	11	60478487	missense	possibly damaging	0.86
R6521:Myo15	UTSW	11	60502369	missense	probably damaging	1.00
R6645:Myo15	UTSW	11	60477292	missense	probably benign	0.00
R6703:Myo15	UTSW	11	60492992	missense	probably benign	0.16
R6821:Myo15	UTSW	11	60524475	missense	probably damaging	1.00
R6882:Myo15	UTSW	11	60524006	missense	probably damaging	1.00
R6908:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R6932:Myo15	UTSW	11	60499494	missense	probably damaging	1.00
R6958:Myo15	UTSW	11	60503625	missense	probably benign	0.07
R7041:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R7149:Myo15	UTSW	11	60510010	missense	possibly damaging	0.56
R7163:Myo15	UTSW	11	60498369	missense
R7229:Myo15	UTSW	11	60496495	missense	probably benign	0.08
R7347:Myo15	UTSW	11	60477961	missense	probably benign
R7368:Myo15	UTSW	11	60490915	splice site	probably null
R7392:Myo15	UTSW	11	60505976	missense
R7414:Myo15	UTSW	11	60483483	missense
R7461:Myo15	UTSW	11	60505152	missense
R7609:Myo15	UTSW	11	60488811	missense
R7613:Myo15	UTSW	11	60505152	missense
R7734:Myo15	UTSW	11	60510282	missense	probably benign
R7748:Myo15	UTSW	11	60504901	missense
R7767:Myo15	UTSW	11	60502096	missense
R7769:Myo15	UTSW	11	60509149	missense
R7894:Myo15	UTSW	11	60491137	missense
R7919:Myo15	UTSW	11	60526530	missense	probably damaging	1.00
R8100:Myo15	UTSW	11	60517190	missense	probably damaging	1.00
R8124:Myo15	UTSW	11	60507453	missense
R8129:Myo15	UTSW	11	60508200	missense
R8428:Myo15	UTSW	11	60496415	missense	probably damaging	1.00
R8706:Myo15	UTSW	11	60479617	missense	probably benign
R8735:Myo15	UTSW	11	60510853	critical splice acceptor site	probably null
R8739:Myo15	UTSW	11	60477262	missense	probably benign	0.06
R8790:Myo15	UTSW	11	60476536	missense	possibly damaging	0.73
R8790:Myo15	UTSW	11	60487221	missense
R8822:Myo15	UTSW	11	60476914	missense	probably damaging	0.99
R8907:Myo15	UTSW	11	60526608	missense
R8931:Myo15	UTSW	11	60477194	missense	probably benign
R9061:Myo15	UTSW	11	60502866	missense
R9124:Myo15	UTSW	11	60479126	missense	probably benign	0.37
R9297:Myo15	UTSW	11	60495073	missense	probably null
R9347:Myo15	UTSW	11	60483729	missense
R9417:Myo15	UTSW	11	60487417	missense
R9456:Myo15	UTSW	11	60501842	missense
R9460:Myo15	UTSW	11	60481740	critical splice donor site	probably null
R9615:Myo15	UTSW	11	60483494	missense
R9630:Myo15	UTSW	11	60517162	missense	probably damaging	1.00
R9746:Myo15	UTSW	11	60487408	nonsense	probably null
X0021:Myo15	UTSW	11	60482359	nonsense	probably null
X0066:Myo15	UTSW	11	60478220	missense	probably damaging	1.00
X0067:Myo15	UTSW	11	60478618	missense	possibly damaging	0.88
Z1176:Myo15	UTSW	11	60488258	missense
Z1176:Myo15	UTSW	11	60498403	missense
Z1176:Myo15	UTSW	11	60524441	missense	probably damaging	1.00
Z1177:Myo15	UTSW	11	60477523	missense	probably damaging	1.00
Z1177:Myo15	UTSW	11	60488837	missense
Z1177:Myo15	UTSW	11	60495475	missense

Predicted Primers

PCR Primer
(F):5'- CAGCTGACTCAGGAAATCAGG -3'
(R):5'- ATCCTTAGTCACTCCAGGGG -3'

Sequencing Primer
(F):5'- CTGACTCAGGAAATCAGGAAGGG -3'
(R):5'- AGATCCTAATACGGCATTTCCTG -3'

Posted On

2018-07-24