Incidental Mutation 'R6702:Pld4'
ID 528829
Institutional Source Beutler Lab
Gene Symbol Pld4
Ensembl Gene ENSMUSG00000052160
Gene Name phospholipase D family member 4
Synonyms thss
MMRRC Submission 044820-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6702 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 112727089-112735420 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112731485 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 213 (S213P)
Ref Sequence ENSEMBL: ENSMUSP00000067002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063888]
AlphaFold Q8BG07
Predicted Effect probably damaging
Transcript: ENSMUST00000063888
AA Change: S213P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067002
Gene: ENSMUSG00000052160
AA Change: S213P

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
PLDc 207 234 1.64e-10 SMART
Pfam:PLDc_3 237 414 5.5e-41 PFAM
PLDc 421 447 4.66e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222886
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: A spontaneous mutation that introduces a stop codon at residue 46 of 503 results in smaller body size and thin fur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,497,558 (GRCm39) Y66* probably null Het
Ak3 A G 19: 29,003,627 (GRCm39) V183A probably damaging Het
Ano10 G T 9: 122,088,630 (GRCm39) Q397K possibly damaging Het
Atg7 C A 6: 114,648,058 (GRCm39) probably null Het
Brpf3 A C 17: 29,029,633 (GRCm39) N531T probably benign Het
Casp2 T C 6: 42,244,985 (GRCm39) V128A probably benign Het
Cdcp2 T C 4: 106,964,283 (GRCm39) C378R probably benign Het
Cfap54 T A 10: 92,704,596 (GRCm39) D2828V unknown Het
Col6a3 T C 1: 90,707,161 (GRCm39) D1984G unknown Het
Csnk2a1 A G 2: 152,100,608 (GRCm39) T93A probably benign Het
Ddx54 T A 5: 120,764,568 (GRCm39) D758E possibly damaging Het
Dlx2 A G 2: 71,376,571 (GRCm39) S56P probably damaging Het
Dna2 T A 10: 62,809,073 (GRCm39) I1055N possibly damaging Het
Dnah10 A G 5: 124,882,869 (GRCm39) Y2909C probably damaging Het
Dnm3 A G 1: 162,146,256 (GRCm39) F296L probably benign Het
Fat1 A G 8: 45,406,083 (GRCm39) T945A probably benign Het
Herpud1 T C 8: 95,119,154 (GRCm39) probably null Het
Iqub T A 6: 24,449,744 (GRCm39) N707I probably damaging Het
Kif26b C G 1: 178,744,852 (GRCm39) S1649R possibly damaging Het
Lamp5 C G 2: 135,901,483 (GRCm39) N102K possibly damaging Het
Ltbr A G 6: 125,285,031 (GRCm39) S290P probably benign Het
Map4k1 T G 7: 28,701,821 (GRCm39) S803A possibly damaging Het
Mef2c T A 13: 83,773,525 (GRCm39) C134S possibly damaging Het
Myo15a A G 11: 60,383,818 (GRCm39) I1622V probably benign Het
Nbea A G 3: 55,912,923 (GRCm39) Y955H probably benign Het
Ndor1 A G 2: 25,139,902 (GRCm39) F142S possibly damaging Het
Nynrin A G 14: 56,101,935 (GRCm39) T535A possibly damaging Het
Or4k15 A G 14: 50,364,688 (GRCm39) Y218C probably damaging Het
Or4k42 T A 2: 111,320,454 (GRCm39) probably null Het
Or5ac23 C T 16: 59,148,961 (GRCm39) V304I probably benign Het
Or5d46 G A 2: 88,170,586 (GRCm39) V226I probably benign Het
Or8b51 A T 9: 38,569,073 (GRCm39) I205N possibly damaging Het
Pcdhb13 T G 18: 37,577,828 (GRCm39) H735Q probably benign Het
Pcdhb7 A T 18: 37,474,959 (GRCm39) M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Per2 C T 1: 91,355,671 (GRCm39) E696K probably damaging Het
Prkg1 T A 19: 30,970,484 (GRCm39) H209L probably benign Het
Psg16 T C 7: 16,824,321 (GRCm39) L35P probably damaging Het
Pxn C T 5: 115,689,955 (GRCm39) L160F probably benign Het
Rab3a A G 8: 71,209,095 (GRCm39) D77G probably damaging Het
Resf1 T A 6: 149,229,376 (GRCm39) N807K probably damaging Het
Rgma A T 7: 73,067,068 (GRCm39) T108S probably damaging Het
Rxrg A G 1: 167,441,374 (GRCm39) S51G probably benign Het
S1pr3 A T 13: 51,573,475 (GRCm39) I219F probably damaging Het
Sec23b A T 2: 144,401,109 (GRCm39) probably null Het
Sfrp5 G T 19: 42,190,266 (GRCm39) T62K probably benign Het
Slco1a6 T A 6: 142,048,826 (GRCm39) Y318F probably damaging Het
Slit1 A C 19: 41,603,309 (GRCm39) S931A possibly damaging Het
Sorl1 A T 9: 41,982,497 (GRCm39) V361E probably damaging Het
St6galnac2 A G 11: 116,575,213 (GRCm39) S209P probably benign Het
Supt6 C A 11: 78,122,626 (GRCm39) R199L possibly damaging Het
Tas2r107 A C 6: 131,636,347 (GRCm39) M234R probably benign Het
Tmem72 C G 6: 116,675,310 (GRCm39) V61L probably benign Het
Trpm5 C A 7: 142,623,055 (GRCm39) probably benign Het
Ttn T G 2: 76,550,456 (GRCm39) T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 (GRCm39) probably benign Het
Ubr3 A T 2: 69,786,393 (GRCm39) R836W probably benign Het
Umodl1 A G 17: 31,205,273 (GRCm39) probably null Het
Ythdf1 A G 2: 180,560,926 (GRCm39) probably null Het
Zfp780b T C 7: 27,671,066 (GRCm39) T81A possibly damaging Het
Zfp811 T C 17: 33,016,816 (GRCm39) E407G probably damaging Het
Other mutations in Pld4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Pld4 APN 12 112,729,925 (GRCm39) missense probably benign 0.01
IGL01839:Pld4 APN 12 112,731,513 (GRCm39) missense probably damaging 1.00
IGL01954:Pld4 APN 12 112,734,355 (GRCm39) critical splice donor site probably null
IGL02253:Pld4 APN 12 112,733,141 (GRCm39) missense probably damaging 1.00
IGL03149:Pld4 APN 12 112,733,263 (GRCm39) missense probably benign 0.00
IGL03278:Pld4 APN 12 112,733,165 (GRCm39) missense probably damaging 0.98
IGL03349:Pld4 APN 12 112,734,313 (GRCm39) missense probably benign 0.01
Lipodicum UTSW 12 112,731,498 (GRCm39) missense probably damaging 1.00
PIT4403001:Pld4 UTSW 12 112,734,256 (GRCm39) missense probably damaging 1.00
PIT4468001:Pld4 UTSW 12 112,734,256 (GRCm39) missense probably damaging 1.00
R0052:Pld4 UTSW 12 112,734,291 (GRCm39) missense probably benign 0.03
R1078:Pld4 UTSW 12 112,729,876 (GRCm39) missense probably benign
R1756:Pld4 UTSW 12 112,729,826 (GRCm39) splice site probably null
R2006:Pld4 UTSW 12 112,734,923 (GRCm39) missense possibly damaging 0.89
R2037:Pld4 UTSW 12 112,734,992 (GRCm39) missense probably damaging 1.00
R3738:Pld4 UTSW 12 112,734,469 (GRCm39) missense probably benign 0.07
R4630:Pld4 UTSW 12 112,731,498 (GRCm39) missense probably damaging 1.00
R4911:Pld4 UTSW 12 112,730,951 (GRCm39) missense probably benign 0.01
R5008:Pld4 UTSW 12 112,734,484 (GRCm39) missense possibly damaging 0.89
R5263:Pld4 UTSW 12 112,731,465 (GRCm39) missense probably damaging 1.00
R5310:Pld4 UTSW 12 112,735,046 (GRCm39) missense probably damaging 1.00
R5386:Pld4 UTSW 12 112,730,422 (GRCm39) nonsense probably null
R5513:Pld4 UTSW 12 112,728,988 (GRCm39) missense probably benign
R5788:Pld4 UTSW 12 112,730,551 (GRCm39) missense probably benign
R6085:Pld4 UTSW 12 112,733,320 (GRCm39) missense probably benign 0.01
R6157:Pld4 UTSW 12 112,734,535 (GRCm39) missense probably damaging 1.00
R6767:Pld4 UTSW 12 112,730,549 (GRCm39) missense possibly damaging 0.51
R6962:Pld4 UTSW 12 112,733,288 (GRCm39) missense probably benign 0.00
R7864:Pld4 UTSW 12 112,731,557 (GRCm39) missense probably damaging 1.00
R8792:Pld4 UTSW 12 112,729,924 (GRCm39) missense probably benign 0.00
R8826:Pld4 UTSW 12 112,733,210 (GRCm39) missense possibly damaging 0.95
R9790:Pld4 UTSW 12 112,734,862 (GRCm39) missense probably damaging 1.00
R9791:Pld4 UTSW 12 112,734,862 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCCTTGATCAGTGGGG -3'
(R):5'- CAAGGTTCTGCTTGCTAACTCC -3'

Sequencing Primer
(F):5'- AGCCTTGATCAGTGGGGTCATTC -3'
(R):5'- TGCTAACTCCTCCCAGTACCAG -3'
Posted On 2018-07-24