Incidental Mutation 'R6702:Mef2c'
ID 528831
Institutional Source Beutler Lab
Gene Symbol Mef2c
Ensembl Gene ENSMUSG00000005583
Gene Name myocyte enhancer factor 2C
Synonyms 9930028G15Rik, 5430401D19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6702 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 83504034-83667080 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83625406 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 134 (C134S)
Ref Sequence ENSEMBL: ENSMUSP00000143611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005722] [ENSMUST00000163888] [ENSMUST00000185052] [ENSMUST00000195904] [ENSMUST00000195984] [ENSMUST00000196207] [ENSMUST00000196493] [ENSMUST00000196730] [ENSMUST00000197146] [ENSMUST00000197681] [ENSMUST00000197722] [ENSMUST00000197938] [ENSMUST00000199450] [ENSMUST00000199019] [ENSMUST00000199105] [ENSMUST00000199432] [ENSMUST00000200394] [ENSMUST00000198069] [ENSMUST00000198199] [ENSMUST00000198217] [ENSMUST00000199167] [ENSMUST00000199210] [ENSMUST00000198064]
AlphaFold Q8CFN5
Predicted Effect probably benign
Transcript: ENSMUST00000005722
SMART Domains Protein: ENSMUSP00000005722
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 154 5.3e-27 PFAM
low complexity region 314 324 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163888
SMART Domains Protein: ENSMUSP00000132547
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 155 1.4e-17 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185052
SMART Domains Protein: ENSMUSP00000138826
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 154 6e-27 PFAM
low complexity region 322 332 N/A INTRINSIC
low complexity region 418 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195904
AA Change: C134S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143339
Gene: ENSMUSG00000005583
AA Change: C134S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 5.8e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000195984
AA Change: C134S

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143611
Gene: ENSMUSG00000005583
AA Change: C134S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 155 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196207
SMART Domains Protein: ENSMUSP00000143221
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 120 2.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196493
SMART Domains Protein: ENSMUSP00000142897
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196730
SMART Domains Protein: ENSMUSP00000143338
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 154 4.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197146
AA Change: C134S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000143227
Gene: ENSMUSG00000005583
AA Change: C134S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 9.5e-15 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197681
AA Change: C134S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000143420
Gene: ENSMUSG00000005583
AA Change: C134S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 9.5e-15 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197722
AA Change: C134S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142456
Gene: ENSMUSG00000005583
AA Change: C134S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 2.8e-12 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197938
SMART Domains Protein: ENSMUSP00000143187
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 154 6.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199450
AA Change: C134S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000143315
Gene: ENSMUSG00000005583
AA Change: C134S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 5.1e-15 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199019
AA Change: C134S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000143401
Gene: ENSMUSG00000005583
AA Change: C134S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 1.1e-14 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199105
AA Change: C134S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000143212
Gene: ENSMUSG00000005583
AA Change: C134S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 1.1e-14 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199432
AA Change: C134S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142714
Gene: ENSMUSG00000005583
AA Change: C134S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 3.1e-12 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200394
AA Change: C134S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000143598
Gene: ENSMUSG00000005583
AA Change: C134S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 155 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198069
SMART Domains Protein: ENSMUSP00000143286
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198199
SMART Domains Protein: ENSMUSP00000143742
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 153 2e-23 PFAM
low complexity region 314 324 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198217
SMART Domains Protein: ENSMUSP00000142487
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 364 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199167
SMART Domains Protein: ENSMUSP00000142884
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 154 6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199210
SMART Domains Protein: ENSMUSP00000142595
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
low complexity region 276 286 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199262
Predicted Effect probably benign
Transcript: ENSMUST00000198064
SMART Domains Protein: ENSMUSP00000142399
Gene: ENSMUSG00000005583

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the MADS box transcription enhancer factor 2 (MEF2) family of proteins, which play a role in myogenesis. The encoded protein, MEF2 polypeptide C, has both trans-activating and DNA binding activities. This protein may play a role in maintaining the differentiated state of muscle cells. Mutations and deletions at this locus have been associated with severe mental retardation, stereotypic movements, epilepsy, and cerebral malformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have cardiovascular abnormalities and die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
2810474O19Rik T A 6: 149,327,878 N807K probably damaging Het
Ak3 A G 19: 29,026,227 V183A probably damaging Het
Ano10 G T 9: 122,259,564 Q397K possibly damaging Het
Atg7 C A 6: 114,671,097 probably null Het
Brpf3 A C 17: 28,810,659 N531T probably benign Het
Casp2 T C 6: 42,268,051 V128A probably benign Het
Cdcp2 T C 4: 107,107,086 C378R probably benign Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Ddx54 T A 5: 120,626,503 D758E possibly damaging Het
Dlx2 A G 2: 71,546,227 S56P probably damaging Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnah10 A G 5: 124,805,805 Y2909C probably damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Herpud1 T C 8: 94,392,526 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kif26b C G 1: 178,917,287 S1649R possibly damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Ltbr A G 6: 125,308,068 S290P probably benign Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Nbea A G 3: 56,005,502 Y955H probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1176 G A 2: 88,340,242 V226I probably benign Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdhb13 T G 18: 37,444,775 H735Q probably benign Het
Pcdhb7 A T 18: 37,341,906 M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pld4 T C 12: 112,765,051 S213P probably damaging Het
Prkg1 T A 19: 30,993,084 H209L probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Pxn C T 5: 115,551,896 L160F probably benign Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rgma A T 7: 73,417,320 T108S probably damaging Het
Rxrg A G 1: 167,613,805 S51G probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Sfrp5 G T 19: 42,201,827 T62K probably benign Het
Slco1a6 T A 6: 142,103,100 Y318F probably damaging Het
Slit1 A C 19: 41,614,870 S931A possibly damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Supt6 C A 11: 78,231,800 R199L possibly damaging Het
Tas2r107 A C 6: 131,659,384 M234R probably benign Het
Tmem72 C G 6: 116,698,349 V61L probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Ttn T G 2: 76,720,112 T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubr3 A T 2: 69,956,049 R836W probably benign Het
Umodl1 A G 17: 30,986,299 probably null Het
Ythdf1 A G 2: 180,919,133 probably null Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Zfp811 T C 17: 32,797,842 E407G probably damaging Het
Other mutations in Mef2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Mef2c APN 13 83625380 missense probably damaging 1.00
IGL01012:Mef2c APN 13 83655595 missense probably damaging 1.00
IGL03131:Mef2c APN 13 83662375 missense probably damaging 1.00
IGL03186:Mef2c APN 13 83652868 missense probably benign 0.03
LCD18:Mef2c UTSW 13 83605823 intron probably benign
R0021:Mef2c UTSW 13 83656240 missense probably damaging 1.00
R0062:Mef2c UTSW 13 83652873 missense possibly damaging 0.65
R0480:Mef2c UTSW 13 83592901 missense probably damaging 1.00
R0755:Mef2c UTSW 13 83656353 critical splice donor site probably null
R1290:Mef2c UTSW 13 83662359 missense probably benign 0.19
R4085:Mef2c UTSW 13 83575702 missense probably damaging 0.98
R4734:Mef2c UTSW 13 83662629 makesense probably null
R5230:Mef2c UTSW 13 83652907 missense possibly damaging 0.89
R5385:Mef2c UTSW 13 83662413 missense probably benign 0.19
R6032:Mef2c UTSW 13 83662359 missense probably benign 0.19
R6032:Mef2c UTSW 13 83662359 missense probably benign 0.19
R6258:Mef2c UTSW 13 83652938 missense probably damaging 1.00
R6670:Mef2c UTSW 13 83662597 missense probably damaging 1.00
R6672:Mef2c UTSW 13 83652856 missense probably damaging 1.00
R6703:Mef2c UTSW 13 83625406 missense possibly damaging 0.70
R6881:Mef2c UTSW 13 83592942 missense probably damaging 1.00
R6907:Mef2c UTSW 13 83654611 missense probably benign 0.32
R7503:Mef2c UTSW 13 83662504 missense possibly damaging 0.80
R8168:Mef2c UTSW 13 83656350 missense probably damaging 0.99
R8438:Mef2c UTSW 13 83656217 missense probably damaging 0.99
R9374:Mef2c UTSW 13 83662342 missense probably benign 0.43
R9552:Mef2c UTSW 13 83662342 missense probably benign 0.43
Z1177:Mef2c UTSW 13 83625266 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TACAGCCTTTGTCTAGGTTTGAAC -3'
(R):5'- AGACCAGCCCTCTACCTTTG -3'

Sequencing Primer
(F):5'- TGTCTAGGTTTGAACTTTGCAC -3'
(R):5'- TTGTTCAATGCCTGCCAG -3'
Posted On 2018-07-24