Incidental Mutation 'R6702:Olfr205'
ID528834
Institutional Source Beutler Lab
Gene Symbol Olfr205
Ensembl Gene ENSMUSG00000094422
Gene Nameolfactory receptor 205
SynonymsMOR182-11P, GA_x54KRFPKG5P-55543875-55542958
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6702 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59328005-59331138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59328598 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 304 (V304I)
Ref Sequence ENSEMBL: ENSMUSP00000149415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074125] [ENSMUST00000213910]
Predicted Effect probably benign
Transcript: ENSMUST00000074125
AA Change: V304I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073762
Gene: ENSMUSG00000094422
AA Change: V304I

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.6e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.6e-7 PFAM
Pfam:7tm_1 40 289 7.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213910
AA Change: V304I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
2810474O19Rik T A 6: 149,327,878 N807K probably damaging Het
Ak3 A G 19: 29,026,227 V183A probably damaging Het
Ano10 G T 9: 122,259,564 Q397K possibly damaging Het
Atg7 C A 6: 114,671,097 probably null Het
Brpf3 A C 17: 28,810,659 N531T probably benign Het
Casp2 T C 6: 42,268,051 V128A probably benign Het
Cdcp2 T C 4: 107,107,086 C378R probably benign Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Ddx54 T A 5: 120,626,503 D758E possibly damaging Het
Dlx2 A G 2: 71,546,227 S56P probably damaging Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnah10 A G 5: 124,805,805 Y2909C probably damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Herpud1 T C 8: 94,392,526 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kif26b C G 1: 178,917,287 S1649R possibly damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Ltbr A G 6: 125,308,068 S290P probably benign Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Nbea A G 3: 56,005,502 Y955H probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1176 G A 2: 88,340,242 V226I probably benign Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdhb13 T G 18: 37,444,775 H735Q probably benign Het
Pcdhb7 A T 18: 37,341,906 M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pld4 T C 12: 112,765,051 S213P probably damaging Het
Prkg1 T A 19: 30,993,084 H209L probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Pxn C T 5: 115,551,896 L160F probably benign Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rgma A T 7: 73,417,320 T108S probably damaging Het
Rxrg A G 1: 167,613,805 S51G probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Sfrp5 G T 19: 42,201,827 T62K probably benign Het
Slco1a6 T A 6: 142,103,100 Y318F probably damaging Het
Slit1 A C 19: 41,614,870 S931A possibly damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Supt6 C A 11: 78,231,800 R199L possibly damaging Het
Tas2r107 A C 6: 131,659,384 M234R probably benign Het
Tmem72 C G 6: 116,698,349 V61L probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Ttn T G 2: 76,720,112 T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubr3 A T 2: 69,956,049 R836W probably benign Het
Umodl1 A G 17: 30,986,299 probably null Het
Ythdf1 A G 2: 180,919,133 probably null Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Zfp811 T C 17: 32,797,842 E407G probably damaging Het
Other mutations in Olfr205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Olfr205 APN 16 59328725 missense probably benign 0.21
IGL03236:Olfr205 APN 16 59328837 missense probably damaging 0.97
R0054:Olfr205 UTSW 16 59329065 missense possibly damaging 0.57
R0054:Olfr205 UTSW 16 59329065 missense possibly damaging 0.57
R0167:Olfr205 UTSW 16 59328974 nonsense probably null
R0178:Olfr205 UTSW 16 59329420 missense probably damaging 1.00
R0371:Olfr205 UTSW 16 59329222 missense possibly damaging 0.60
R0577:Olfr205 UTSW 16 59328698 missense probably benign 0.01
R0597:Olfr205 UTSW 16 59328760 missense probably damaging 1.00
R0967:Olfr205 UTSW 16 59329183 missense possibly damaging 0.66
R1670:Olfr205 UTSW 16 59329244 missense probably benign 0.03
R1702:Olfr205 UTSW 16 59329141 missense probably benign 0.12
R1995:Olfr205 UTSW 16 59329291 missense probably damaging 1.00
R2239:Olfr205 UTSW 16 59329375 missense probably damaging 0.99
R4063:Olfr205 UTSW 16 59328880 missense probably benign 0.05
R4400:Olfr205 UTSW 16 59328598 missense probably benign
R4666:Olfr205 UTSW 16 59329210 missense possibly damaging 0.91
R4795:Olfr205 UTSW 16 59328850 missense probably benign 0.09
R5327:Olfr205 UTSW 16 59329098 missense probably benign 0.01
R5471:Olfr205 UTSW 16 59328631 missense probably damaging 1.00
R5770:Olfr205 UTSW 16 59329151 nonsense probably null
R6195:Olfr205 UTSW 16 59329422 missense possibly damaging 0.81
R7686:Olfr205 UTSW 16 59329016 missense probably damaging 1.00
R7908:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7911:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7912:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7913:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7998:Olfr205 UTSW 16 59329270 missense probably benign 0.09
R8772:Olfr205 UTSW 16 59328688 missense probably damaging 1.00
X0026:Olfr205 UTSW 16 59329350 missense probably benign 0.09
Predicted Primers
Posted On2018-07-24