Mutagenetix > Incidental Mutation

Incidental Mutation 'R6702:Brpf3'

528835

Institutional Source

Beutler Lab

Gene Symbol

Brpf3

Ensembl Gene

ENSMUSG00000063952

Gene Name

bromodomain and PHD finger containing, 3

Synonyms

MMRRC Submission

044820-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.414) question?

Stock #

R6702 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28801090-28838546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 28810659 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 531 (N531T)

Ref Sequence

ENSEMBL: ENSMUSP00000004985 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004985]

AlphaFold

B2KF05

Predicted Effect

probably benign
Transcript: ENSMUST00000004985
AA Change: N531T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000004985
Gene: ENSMUSG00000063952
AA Change: N531T

Domain	Start	End	E-Value	Type
Pfam:EPL1	48	194	8.4e-38	PFAM
PHD	214	260	7.07e-5	SMART
PHD	324	387	4.74e-6	SMART
low complexity region	405	436	N/A	INTRINSIC
Blast:BROMO	491	534	7e-21	BLAST
low complexity region	558	577	N/A	INTRINSIC
BROMO	586	694	4.93e-39	SMART
low complexity region	777	792	N/A	INTRINSIC
low complexity region	813	823	N/A	INTRINSIC
PWWP	1073	1156	2.07e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123942

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126868

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136233

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156029

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

97% (59/61)

MGI Phenotype

PHENOTYPE: Homozygous knockout does not result in any obvious neurological, behavioral, developmental, histological, hematological, survival or reproductive phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	T	A	10: 21,621,659	Y66*	probably null	Het
2810474O19Rik	T	A	6: 149,327,878	N807K	probably damaging	Het
Ak3	A	G	19: 29,026,227	V183A	probably damaging	Het
Ano10	G	T	9: 122,259,564	Q397K	possibly damaging	Het
Atg7	C	A	6: 114,671,097		probably null	Het
Casp2	T	C	6: 42,268,051	V128A	probably benign	Het
Cdcp2	T	C	4: 107,107,086	C378R	probably benign	Het
Cfap54	T	A	10: 92,868,734	D2828V	unknown	Het
Col6a3	T	C	1: 90,779,439	D1984G	unknown	Het
Csnk2a1	A	G	2: 152,258,688	T93A	probably benign	Het
Ddx54	T	A	5: 120,626,503	D758E	possibly damaging	Het
Dlx2	A	G	2: 71,546,227	S56P	probably damaging	Het
Dna2	T	A	10: 62,973,294	I1055N	possibly damaging	Het
Dnah10	A	G	5: 124,805,805	Y2909C	probably damaging	Het
Dnm3	A	G	1: 162,318,687	F296L	probably benign	Het
Fat1	A	G	8: 44,953,046	T945A	probably benign	Het
Herpud1	T	C	8: 94,392,526		probably null	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Kif26b	C	G	1: 178,917,287	S1649R	possibly damaging	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Ltbr	A	G	6: 125,308,068	S290P	probably benign	Het
Map4k1	T	G	7: 29,002,396	S803A	possibly damaging	Het
Mef2c	T	A	13: 83,625,406	C134S	possibly damaging	Het
Myo15	A	G	11: 60,492,992	I1622V	probably benign	Het
Nbea	A	G	3: 56,005,502	Y955H	probably benign	Het
Ndor1	A	G	2: 25,249,890	F142S	possibly damaging	Het
Nynrin	A	G	14: 55,864,478	T535A	possibly damaging	Het
Olfr1176	G	A	2: 88,340,242	V226I	probably benign	Het
Olfr1290	T	A	2: 111,490,109		probably null	Het
Olfr205	C	T	16: 59,328,598	V304I	probably benign	Het
Olfr727	A	G	14: 50,127,231	Y218C	probably damaging	Het
Olfr916	A	T	9: 38,657,777	I205N	possibly damaging	Het
Pcdhb13	T	G	18: 37,444,775	H735Q	probably benign	Het
Pcdhb7	A	T	18: 37,341,906	M32L	probably benign	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Per2	C	T	1: 91,427,949	E696K	probably damaging	Het
Pld4	T	C	12: 112,765,051	S213P	probably damaging	Het
Prkg1	T	A	19: 30,993,084	H209L	probably benign	Het
Psg16	T	C	7: 17,090,396	L35P	probably damaging	Het
Pxn	C	T	5: 115,551,896	L160F	probably benign	Het
Rab3a	A	G	8: 70,756,448	D77G	probably damaging	Het
Rgma	A	T	7: 73,417,320	T108S	probably damaging	Het
Rxrg	A	G	1: 167,613,805	S51G	probably benign	Het
S1pr3	A	T	13: 51,419,439	I219F	probably damaging	Het
Sec23b	A	T	2: 144,559,189		probably null	Het
Sfrp5	G	T	19: 42,201,827	T62K	probably benign	Het
Slco1a6	T	A	6: 142,103,100	Y318F	probably damaging	Het
Slit1	A	C	19: 41,614,870	S931A	possibly damaging	Het
Sorl1	A	T	9: 42,071,201	V361E	probably damaging	Het
St6galnac2	A	G	11: 116,684,387	S209P	probably benign	Het
Supt6	C	A	11: 78,231,800	R199L	possibly damaging	Het
Tas2r107	A	C	6: 131,659,384	M234R	probably benign	Het
Tmem72	C	G	6: 116,698,349	V61L	probably benign	Het
Trpm5	C	A	7: 143,069,318		probably benign	Het
Ttn	T	G	2: 76,720,112	T23282P	probably damaging	Het
Ubap2	GCCCGCTTGCCCCGCT	GCCCGCTTGCCCCGCTTGCCCCGCT	4: 41,227,210		probably benign	Het
Ubr3	A	T	2: 69,956,049	R836W	probably benign	Het
Umodl1	A	G	17: 30,986,299		probably null	Het
Ythdf1	A	G	2: 180,919,133		probably null	Het
Zfp780b	T	C	7: 27,971,641	T81A	possibly damaging	Het
Zfp811	T	C	17: 32,797,842	E407G	probably damaging	Het

Other mutations in Brpf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00906:Brpf3	APN	17	28836700	utr 3 prime	probably benign
IGL01397:Brpf3	APN	17	28817632	missense	probably benign	0.22
IGL01608:Brpf3	APN	17	28821517	missense	probably benign	0.00
IGL02073:Brpf3	APN	17	28807396	missense	probably benign
IGL02540:Brpf3	APN	17	28828354	missense	probably damaging	1.00
IGL02838:Brpf3	APN	17	28835784	missense	probably benign	0.19
IGL02888:Brpf3	APN	17	28828391	missense	probably damaging	1.00
IGL02969:Brpf3	APN	17	28821305	missense	probably benign	0.05
IGL03036:Brpf3	APN	17	28824048	missense	possibly damaging	0.89
IGL03084:Brpf3	APN	17	28835777	missense	probably damaging	0.98
R0448:Brpf3	UTSW	17	28806036	missense	probably benign	0.10
R0898:Brpf3	UTSW	17	28806990	missense	possibly damaging	0.65
R1268:Brpf3	UTSW	17	28836556	missense	probably damaging	0.98
R1639:Brpf3	UTSW	17	28824068	critical splice donor site	probably null
R1754:Brpf3	UTSW	17	28821323	missense	probably benign	0.00
R1867:Brpf3	UTSW	17	28807368	missense	probably benign
R1954:Brpf3	UTSW	17	28806559	missense	probably benign
R2000:Brpf3	UTSW	17	28821557	missense	probably benign	0.20
R2064:Brpf3	UTSW	17	28821364	missense	probably benign
R2209:Brpf3	UTSW	17	28828420	missense	probably damaging	0.98
R2413:Brpf3	UTSW	17	28805950	start gained	probably benign
R3977:Brpf3	UTSW	17	28807042	missense	possibly damaging	0.49
R4067:Brpf3	UTSW	17	28821259	missense	probably benign
R4291:Brpf3	UTSW	17	28823975	missense	probably benign	0.00
R4369:Brpf3	UTSW	17	28836620	missense	probably damaging	1.00
R4371:Brpf3	UTSW	17	28836620	missense	probably damaging	1.00
R4741:Brpf3	UTSW	17	28817784	missense	possibly damaging	0.50
R4773:Brpf3	UTSW	17	28821259	missense	probably benign	0.00
R4824:Brpf3	UTSW	17	28806486	missense	probably benign
R5360:Brpf3	UTSW	17	28810562	missense	probably benign
R5923:Brpf3	UTSW	17	28806636	missense	possibly damaging	0.90
R6181:Brpf3	UTSW	17	28810581	missense	probably damaging	1.00
R6278:Brpf3	UTSW	17	28821284	missense	probably benign	0.00
R6884:Brpf3	UTSW	17	28831350	missense	probably benign	0.03
R6920:Brpf3	UTSW	17	28823996	missense	probably benign	0.34
R6976:Brpf3	UTSW	17	28835777	missense	probably damaging	0.98
R7099:Brpf3	UTSW	17	28806637	missense	probably benign	0.06
R7108:Brpf3	UTSW	17	28817125	missense	probably benign	0.01
R7193:Brpf3	UTSW	17	28836691	makesense	probably null
R7316:Brpf3	UTSW	17	28814686	missense	probably damaging	1.00
R7326:Brpf3	UTSW	17	28806293	missense	probably benign	0.00
R7403:Brpf3	UTSW	17	28821356	missense	probably benign
R7666:Brpf3	UTSW	17	28810572	missense	possibly damaging	0.83
R7686:Brpf3	UTSW	17	28806934	missense	probably damaging	0.98
R7691:Brpf3	UTSW	17	28806831	missense	probably damaging	1.00
R8054:Brpf3	UTSW	17	28836597	missense	probably damaging	1.00
R8165:Brpf3	UTSW	17	28806274	missense	probably benign	0.01
R8200:Brpf3	UTSW	17	28806274	missense	probably benign	0.01
R8698:Brpf3	UTSW	17	28818462	missense	probably damaging	0.99
R8722:Brpf3	UTSW	17	28810536	missense	probably benign	0.42
R8738:Brpf3	UTSW	17	28821240	missense	probably benign
R9044:Brpf3	UTSW	17	28806897	missense	possibly damaging	0.90
R9250:Brpf3	UTSW	17	28835814	missense	probably damaging	1.00
R9349:Brpf3	UTSW	17	28821302	missense	probably benign	0.00
R9496:Brpf3	UTSW	17	28821479	missense	probably benign
R9564:Brpf3	UTSW	17	28807178	missense	probably benign
R9649:Brpf3	UTSW	17	28818623	missense	probably benign
R9720:Brpf3	UTSW	17	28807356	missense	probably benign	0.13
Z1177:Brpf3	UTSW	17	28821478	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGAATGGGATGTACAGCGAGC -3'
(R):5'- GCTGGTAAACTCTTCTGGACAG -3'

Sequencing Primer
(F):5'- GCGTGTATCCCGAGCTTC -3'
(R):5'- TCTTCTGGACAGATCACTCAGAGG -3'

Posted On

2018-07-24