Incidental Mutation 'R6704:Ermn'
ID528847
Institutional Source Beutler Lab
Gene Symbol Ermn
Ensembl Gene ENSMUSG00000026830
Gene Nameermin, ERM-like protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location58045113-58052864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58048034 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 189 (D189G)
Ref Sequence ENSEMBL: ENSMUSP00000088458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090940] [ENSMUST00000166729]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090940
AA Change: D189G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088458
Gene: ENSMUSG00000026830
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 169 202 N/A INTRINSIC
SCOP:d1ef1c_ 249 278 5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144671
Predicted Effect probably benign
Transcript: ENSMUST00000166729
SMART Domains Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 2.1e-30 PFAM
Pfam:Glyco_transf_7C 652 718 7e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Ermn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Ermn APN 2 58052695 missense possibly damaging 0.84
IGL01620:Ermn APN 2 58052490 missense probably benign 0.05
IGL02756:Ermn APN 2 58047812 missense probably damaging 1.00
IGL03354:Ermn APN 2 58052622 missense probably benign 0.26
FR4304:Ermn UTSW 2 58048078 unclassified probably benign
FR4304:Ermn UTSW 2 58048086 unclassified probably benign
FR4449:Ermn UTSW 2 58048074 unclassified probably benign
FR4548:Ermn UTSW 2 58048075 unclassified probably benign
FR4548:Ermn UTSW 2 58048088 unclassified probably benign
FR4589:Ermn UTSW 2 58048069 unclassified probably benign
FR4976:Ermn UTSW 2 58048080 unclassified probably benign
FR4976:Ermn UTSW 2 58048088 unclassified probably benign
R0827:Ermn UTSW 2 58048251 missense probably damaging 1.00
R1655:Ermn UTSW 2 58052584 missense probably benign 0.01
R1799:Ermn UTSW 2 58048237 missense probably benign 0.06
R5691:Ermn UTSW 2 58047764 missense probably damaging 1.00
R6311:Ermn UTSW 2 58051759 missense probably damaging 1.00
R7444:Ermn UTSW 2 58048067 unclassified probably benign
RF028:Ermn UTSW 2 58048066 unclassified probably benign
RF031:Ermn UTSW 2 58048066 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAATTCCTGGCGATATCTCCC -3'
(R):5'- TTCCTCCGAACAGCAGTAAC -3'

Sequencing Primer
(F):5'- CTTCTTTCCGAACACTGGCTG -3'
(R):5'- TCCGAACAGCAGTAACCTGGAAG -3'
Posted On2018-07-24