Incidental Mutation 'R6704:Serpini1'
ID528850
Institutional Source Beutler Lab
Gene Symbol Serpini1
Ensembl Gene ENSMUSG00000027834
Gene Nameserine (or cysteine) peptidase inhibitor, clade I, member 1
SynonymsNeuroserpin, Spi17, Ns, PI12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location75557547-75643495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75637948 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 337 (V337A)
Ref Sequence ENSEMBL: ENSMUSP00000029423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029423]
PDB Structure Crystal Structure of Mouse Neuroserpin (Cleaved form) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029423
AA Change: V337A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029423
Gene: ENSMUSG00000027834
AA Change: V337A

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
SERPIN 31 397 1.46e-158 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The protein is primarily secreted by axons in the brain, and preferentially reacts with and inhibits tissue-type plasminogen activator. It is thought to play a role in the regulation of axonal growth and the development of synaptic plasticity. Mutations in this gene result in familial encephalopathy with neuroserpin inclusion bodies (FENIB), which is a dominantly inherited form of familial encephalopathy and epilepsy characterized by the accumulation of mutant neuroserpin polymers. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene show no change in brain morphology or histology. However, they show an increase avoidance of novel stimuli and increased anxiety responses in some situations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Serpini1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Serpini1 APN 3 75640695 nonsense probably null
IGL02131:Serpini1 APN 3 75640704 missense probably benign 0.15
IGL02265:Serpini1 APN 3 75619269 missense probably damaging 0.96
IGL03151:Serpini1 APN 3 75613296 missense probably benign 0.00
IGL03232:Serpini1 APN 3 75638010 splice site probably benign
IGL03256:Serpini1 APN 3 75619174 missense probably benign 0.04
R0021:Serpini1 UTSW 3 75619313 missense probably damaging 1.00
R0021:Serpini1 UTSW 3 75619313 missense probably damaging 1.00
R0449:Serpini1 UTSW 3 75613341 missense probably benign 0.06
R0941:Serpini1 UTSW 3 75616627 missense probably damaging 0.97
R1641:Serpini1 UTSW 3 75614670 missense possibly damaging 0.94
R1968:Serpini1 UTSW 3 75614478 missense probably benign 0.34
R1993:Serpini1 UTSW 3 75614664 missense probably damaging 1.00
R2159:Serpini1 UTSW 3 75623944 missense probably benign 0.06
R3418:Serpini1 UTSW 3 75640282 missense probably damaging 1.00
R3419:Serpini1 UTSW 3 75640282 missense probably damaging 1.00
R3780:Serpini1 UTSW 3 75614635 missense probably damaging 0.96
R4618:Serpini1 UTSW 3 75616576 missense probably benign 0.29
R4864:Serpini1 UTSW 3 75613174 missense probably benign 0.01
R4989:Serpini1 UTSW 3 75614488 missense probably benign 0.07
R5080:Serpini1 UTSW 3 75616660 missense probably damaging 1.00
R5324:Serpini1 UTSW 3 75640294 missense probably damaging 1.00
R5767:Serpini1 UTSW 3 75613081 splice site probably benign
R5817:Serpini1 UTSW 3 75613324 missense probably benign 0.07
R5912:Serpini1 UTSW 3 75616607 missense probably benign 0.04
R5944:Serpini1 UTSW 3 75640299 missense probably damaging 1.00
R7716:Serpini1 UTSW 3 75616714 missense probably damaging 1.00
R8696:Serpini1 UTSW 3 75613237 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCACACCATTGCTAGTTCTC -3'
(R):5'- CTGGCTGCTTTAAAATCTGCTTG -3'

Sequencing Primer
(F):5'- CCTGTGCCGTAAGTAAAATCTGTC -3'
(R):5'- CTGACTTGGAAAACAGTGGCCTC -3'
Posted On2018-07-24