Incidental Mutation 'R6704:Ugt2b36'
ID528853
Institutional Source Beutler Lab
Gene Symbol Ugt2b36
Ensembl Gene ENSMUSG00000070704
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B36
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location87065927-87092555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87092131 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 132 (V132F)
Ref Sequence ENSEMBL: ENSMUSP00000092233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094649] [ENSMUST00000132667] [ENSMUST00000145617]
Predicted Effect probably damaging
Transcript: ENSMUST00000094649
AA Change: V132F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092233
Gene: ENSMUSG00000070704
AA Change: V132F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 6.9e-260 PFAM
Pfam:Glyco_tran_28_C 339 448 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132667
SMART Domains Protein: ENSMUSP00000123024
Gene: ENSMUSG00000070704

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 105 1.1e-23 PFAM
Pfam:UDPGT 99 265 7.4e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145617
SMART Domains Protein: ENSMUSP00000120005
Gene: ENSMUSG00000070704

DomainStartEndE-ValueType
Pfam:UDPGT 22 249 2.1e-127 PFAM
Pfam:Glyco_tran_28_C 164 245 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154455
SMART Domains Protein: ENSMUSP00000120633
Gene: ENSMUSG00000070704

DomainStartEndE-ValueType
Pfam:UDPGT 1 198 1.2e-117 PFAM
Pfam:Glyco_tran_28_C 109 194 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Ugt2b36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Ugt2b36 APN 5 87081581 missense possibly damaging 0.73
IGL01024:Ugt2b36 APN 5 87080869 critical splice donor site probably null
IGL01295:Ugt2b36 APN 5 87080885 missense probably damaging 1.00
IGL01331:Ugt2b36 APN 5 87090942 missense probably damaging 1.00
IGL02597:Ugt2b36 APN 5 87080924 missense probably damaging 1.00
IGL02967:Ugt2b36 APN 5 87090900 missense possibly damaging 0.48
IGL03053:Ugt2b36 APN 5 87092074 missense possibly damaging 0.95
R0370:Ugt2b36 UTSW 5 87091975 missense probably benign 0.04
R0616:Ugt2b36 UTSW 5 87089477 missense probably benign 0.01
R0827:Ugt2b36 UTSW 5 87066375 missense possibly damaging 0.83
R0885:Ugt2b36 UTSW 5 87091989 missense probably benign 0.03
R1471:Ugt2b36 UTSW 5 87092071 missense probably damaging 1.00
R1567:Ugt2b36 UTSW 5 87092399 missense probably damaging 1.00
R1782:Ugt2b36 UTSW 5 87081581 missense possibly damaging 0.73
R1974:Ugt2b36 UTSW 5 87080868 critical splice donor site probably null
R2065:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2066:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2068:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2111:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2272:Ugt2b36 UTSW 5 87066255 missense possibly damaging 0.65
R2696:Ugt2b36 UTSW 5 87089485 missense probably damaging 1.00
R4626:Ugt2b36 UTSW 5 87092088 missense probably damaging 1.00
R4700:Ugt2b36 UTSW 5 87092442 critical splice donor site probably null
R4731:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4732:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4733:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4922:Ugt2b36 UTSW 5 87066324 missense probably damaging 1.00
R5217:Ugt2b36 UTSW 5 87066255 missense probably damaging 0.97
R5244:Ugt2b36 UTSW 5 87091906 missense probably damaging 0.99
R5341:Ugt2b36 UTSW 5 87092228 nonsense probably null
R5478:Ugt2b36 UTSW 5 87089482 missense probably damaging 1.00
R5572:Ugt2b36 UTSW 5 87089482 missense possibly damaging 0.89
R5722:Ugt2b36 UTSW 5 87092438 nonsense probably null
R5961:Ugt2b36 UTSW 5 87080865 splice site probably null
R6034:Ugt2b36 UTSW 5 87081518 missense probably damaging 1.00
R6034:Ugt2b36 UTSW 5 87081518 missense probably damaging 1.00
R6139:Ugt2b36 UTSW 5 87092171 missense probably benign
R6145:Ugt2b36 UTSW 5 87066213 missense probably benign
R6226:Ugt2b36 UTSW 5 87092130 missense probably damaging 0.99
R6531:Ugt2b36 UTSW 5 87081586 missense probably damaging 1.00
R6895:Ugt2b36 UTSW 5 87092298 missense probably benign 0.06
R7218:Ugt2b36 UTSW 5 87081539 missense probably damaging 1.00
R7258:Ugt2b36 UTSW 5 87080903 missense probably damaging 1.00
R7310:Ugt2b36 UTSW 5 87066279 missense possibly damaging 0.94
R7650:Ugt2b36 UTSW 5 87080972 missense probably damaging 1.00
R7707:Ugt2b36 UTSW 5 87081508 critical splice donor site probably null
R7866:Ugt2b36 UTSW 5 87092331 missense probably damaging 1.00
R7967:Ugt2b36 UTSW 5 87066377 missense probably damaging 1.00
R7985:Ugt2b36 UTSW 5 87092124 missense probably damaging 1.00
R8098:Ugt2b36 UTSW 5 87092393 missense probably benign 0.02
R8123:Ugt2b36 UTSW 5 87092436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATTTGACCACTTAATCCTGAC -3'
(R):5'- CGCCTGGCCTTAAGTTTGAAAC -3'

Sequencing Primer
(F):5'- CCACTTAATCCTGACAAAATTACAGG -3'
(R):5'- GATGGACTTATGAGGTTCCA -3'
Posted On2018-07-24