Incidental Mutation 'R6704:Hyou1'
ID528861
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Namehypoxia up-regulated 1
SynonymsGrp170, Cab140, Orp150, 140 kDa, CBP-140
MMRRC Submission
Accession Numbers

Genbank: NM_021395; MGI: 108030

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44379490-44392369 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 44381134 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000066601] [ENSMUST00000159473] [ENSMUST00000160902] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000161318] [ENSMUST00000162560] [ENSMUST00000217019] [ENSMUST00000217019]
Predicted Effect probably null
Transcript: ENSMUST00000066601
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066601
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159473
SMART Domains Protein: ENSMUSP00000124177
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:HSP70 38 226 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160112
Predicted Effect probably null
Transcript: ENSMUST00000160902
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160902
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161318
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161318
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161537
Predicted Effect probably benign
Transcript: ENSMUST00000162560
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217019
Predicted Effect probably null
Transcript: ENSMUST00000217019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217460
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44385146 missense probably benign 0.02
IGL01660:Hyou1 APN 9 44381117 missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44382012 missense probably benign 0.21
IGL01903:Hyou1 APN 9 44381141 splice site probably benign
IGL02636:Hyou1 APN 9 44381410 critical splice donor site probably null
IGL02806:Hyou1 APN 9 44388883 nonsense probably null
IGL03401:Hyou1 APN 9 44384909 missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44388058 missense probably benign
ANU74:Hyou1 UTSW 9 44381263 missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44384477 missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44390851 missense probably benign 0.26
R0408:Hyou1 UTSW 9 44384692 missense probably damaging 1.00
R0422:Hyou1 UTSW 9 44389242 missense probably damaging 1.00
R1116:Hyou1 UTSW 9 44384681 missense probably damaging 1.00
R1581:Hyou1 UTSW 9 44388870 missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44389406 missense probably benign 0.02
R1803:Hyou1 UTSW 9 44384182 nonsense probably null
R2060:Hyou1 UTSW 9 44381552 missense probably benign 0.28
R2180:Hyou1 UTSW 9 44388019 missense probably benign 0.30
R2233:Hyou1 UTSW 9 44389091 missense probably benign 0.44
R2235:Hyou1 UTSW 9 44389091 missense probably benign 0.44
R3950:Hyou1 UTSW 9 44385227 missense probably damaging 1.00
R4198:Hyou1 UTSW 9 44388859 missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44388859 missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44380615 splice site probably null
R4393:Hyou1 UTSW 9 44381872 missense probably damaging 1.00
R4394:Hyou1 UTSW 9 44381872 missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44387121 intron probably benign
R5239:Hyou1 UTSW 9 44385263 missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44385249 missense probably damaging 0.99
R5818:Hyou1 UTSW 9 44388926 critical splice donor site probably null
R5856:Hyou1 UTSW 9 44381344 missense probably damaging 1.00
R6431:Hyou1 UTSW 9 44382025 critical splice donor site probably null
R6594:Hyou1 UTSW 9 44389322 missense probably benign
R6596:Hyou1 UTSW 9 44387755 missense probably benign 0.00
R6613:Hyou1 UTSW 9 44382498 missense probably damaging 0.99
R6849:Hyou1 UTSW 9 44387264 missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44389409 missense probably benign 0.04
R7632:Hyou1 UTSW 9 44381136 splice site probably null
R7711:Hyou1 UTSW 9 44384462 missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44385585 missense possibly damaging 0.80
R8287:Hyou1 UTSW 9 44388133 missense probably benign 0.26
X0027:Hyou1 UTSW 9 44390856 missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44387742 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCAGACTGTGATGGCTGAGC -3'
(R):5'- TCATGTTCTGGGAAACGGGAC -3'

Sequencing Primer
(F):5'- TGAGCCCCCGTATGAGATCTG -3'
(R):5'- ATCCGCCTGTTTTCCAAGGAGG -3'
Posted On2018-07-24