Mutagenetix > Incidental Mutation

Incidental Mutation 'R6704:Utrn'

528864

Institutional Source

Beutler Lab

Gene Symbol

Utrn

Ensembl Gene

ENSMUSG00000019820

Gene Name

utrophin

Synonyms

G-utrophin, DRP, Dmdl

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6704 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12382188-12869365 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12745291 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 212 (E212G)

Ref Sequence

ENSEMBL: ENSMUSP00000151359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000217899] [ENSMUST00000218635] [ENSMUST00000219130] [ENSMUST00000219163] [ENSMUST00000219584] [ENSMUST00000219660]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000076817
AA Change: E212G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: E212G

Domain	Start	End	E-Value	Type
CH	33	133	1.87e-24	SMART
CH	152	250	4.05e-20	SMART
SPEC	312	416	2.31e-18	SMART
SPEC	421	525	4.18e-16	SMART
SPEC	532	636	3.35e-6	SMART
low complexity region	665	679	N/A	INTRINSIC
SPEC	690	795	1.7e-7	SMART
SPEC	801	901	1e-4	SMART
SPEC	910	1012	8.24e-2	SMART
SPEC	1019	1121	1.32e-4	SMART
SPEC	1128	1229	2.64e-4	SMART
SPEC	1236	1333	4.42e-6	SMART
coiled coil region	1375	1401	N/A	INTRINSIC
SPEC	1438	1540	3.62e-2	SMART
SPEC	1547	1648	7.95e-1	SMART
SPEC	1655	1752	3.56e0	SMART
coiled coil region	1766	1795	N/A	INTRINSIC
SPEC	1870	1972	3.63e0	SMART
SPEC	1979	2080	5.15e-16	SMART
SPEC	2087	2183	3.71e0	SMART
SPEC	2227	2330	4.7e-10	SMART
SPEC	2337	2437	1.02e0	SMART
SPEC	2444	2553	2.35e-10	SMART
SPEC	2560	2685	8.77e-10	SMART
SPEC	2692	2794	4.13e-6	SMART
WW	2811	2843	5.59e-7	SMART
Pfam:EF-hand_2	2844	2962	3.8e-41	PFAM
Pfam:EF-hand_3	2966	3057	1.6e-39	PFAM
ZnF_ZZ	3062	3107	6.33e-17	SMART
coiled coil region	3250	3289	N/A	INTRINSIC
coiled coil region	3310	3354	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217899
AA Change: E217G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218635
AA Change: E212G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000219130

Predicted Effect

probably benign
Transcript: ENSMUST00000219163

Predicted Effect

probably damaging
Transcript: ENSMUST00000219584
AA Change: E212G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000219660
AA Change: E212G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apob	T	C	12: 8,010,379	S2921P	probably damaging	Het
Asxl3	G	A	18: 22,517,305	A784T	probably benign	Het
Atm	T	C	9: 53,458,853	I2320V	probably benign	Het
Ccdc152	T	A	15: 3,280,713	I227F	probably damaging	Het
Cd109	T	C	9: 78,680,075	V675A	probably benign	Het
Col3a1	T	C	1: 45,347,732	Y235H	probably damaging	Het
Dnmbp	T	C	19: 43,901,213	D705G	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Ermn	T	C	2: 58,048,034	D189G	possibly damaging	Het
Evx2	C	A	2: 74,656,155	A297S	probably damaging	Het
Fat1	T	C	8: 45,024,373	F2152S	probably damaging	Het
Fndc1	A	G	17: 7,771,810	V1018A	unknown	Het
Hyou1	T	C	9: 44,381,134		probably null	Het
Kcnma1	G	A	14: 24,002,814	Q187*	probably null	Het
Macf1	C	T	4: 123,410,762		probably benign	Het
Mcam	T	A	9: 44,136,920	D124E	probably benign	Het
Mical3	T	C	6: 121,009,800		probably benign	Het
Mlxipl	A	T	5: 135,137,240		probably null	Het
Myt1	A	G	2: 181,811,212	M1V	probably null	Het
Nlrc3	C	T	16: 3,965,081	V155I	probably damaging	Het
Nlrp2	A	C	7: 5,325,041	L671*	probably null	Het
Olfr187	T	C	16: 59,035,862	R292G	probably damaging	Het
Olfr824	T	A	10: 130,126,155	K301*	probably null	Het
Omd	A	G	13: 49,589,873	D133G	probably damaging	Het
Pappa	G	A	4: 65,204,924	C832Y	probably damaging	Het
Pcnx3	A	T	19: 5,686,487	V174E	possibly damaging	Het
Pfkl	C	T	10: 77,996,366	G297D	probably damaging	Het
Polr3a	A	G	14: 24,461,842	L882P	probably damaging	Het
Ptchd4	A	G	17: 42,317,040	T131A	probably benign	Het
Rad50	T	C	11: 53,698,918	N152S	probably damaging	Het
Ruvbl1	T	A	6: 88,479,205	M147K	probably benign	Het
Sept4	T	A	11: 87,589,030	I277N	probably damaging	Het
Serpini1	T	C	3: 75,637,948	V337A	probably damaging	Het
Tmem131	A	G	1: 36,796,180	V1620A	possibly damaging	Het
Tpr	A	G	1: 150,406,508	E248G	possibly damaging	Het
Ugt2b36	C	A	5: 87,092,131	V132F	probably damaging	Het
Zc2hc1c	A	T	12: 85,290,484	Q305L	possibly damaging	Het

Other mutations in Utrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Utrn	APN	10	12671830	missense	probably damaging	1.00
IGL00469:Utrn	APN	10	12406529	missense	probably damaging	1.00
IGL00518:Utrn	APN	10	12666843	splice site	probably benign
IGL00560:Utrn	APN	10	12455467	nonsense	probably null
IGL00589:Utrn	APN	10	12678618	missense	possibly damaging	0.53
IGL00662:Utrn	APN	10	12664961	missense	probably damaging	0.99
IGL00754:Utrn	APN	10	12663492	missense	probably benign	0.05
IGL00772:Utrn	APN	10	12649185	missense	probably benign
IGL00775:Utrn	APN	10	12745230	critical splice donor site	probably null
IGL00782:Utrn	APN	10	12652811	missense	probably benign	0.13
IGL00962:Utrn	APN	10	12481334	missense	possibly damaging	0.80
IGL01584:Utrn	APN	10	12726367	missense	probably benign	0.01
IGL01677:Utrn	APN	10	12744157	missense	probably damaging	1.00
IGL01695:Utrn	APN	10	12745342	missense	probably benign	0.00
IGL01743:Utrn	APN	10	12711557	missense	possibly damaging	0.94
IGL01815:Utrn	APN	10	12652716	missense	probably benign	0.00
IGL01901:Utrn	APN	10	12640928	missense	probably damaging	1.00
IGL01982:Utrn	APN	10	12748029	missense	probably damaging	1.00
IGL01983:Utrn	APN	10	12669781	missense	probably benign	0.18
IGL02031:Utrn	APN	10	12735204	missense	probably damaging	1.00
IGL02106:Utrn	APN	10	12413973	missense	possibly damaging	0.92
IGL02134:Utrn	APN	10	12643419	missense	probably damaging	0.99
IGL02209:Utrn	APN	10	12683295	missense	probably damaging	0.97
IGL02217:Utrn	APN	10	12751559	missense	probably damaging	1.00
IGL02250:Utrn	APN	10	12436391	missense	probably damaging	1.00
IGL02307:Utrn	APN	10	12750065	nonsense	probably null
IGL02386:Utrn	APN	10	12421608	missense	possibly damaging	0.91
IGL02494:Utrn	APN	10	12710054	missense	probably benign
IGL02631:Utrn	APN	10	12710063	missense	probably benign	0.00
IGL02729:Utrn	APN	10	12720810	unclassified	probably benign
IGL02736:Utrn	APN	10	12421640	missense	probably damaging	1.00
IGL02832:Utrn	APN	10	12738193	missense	possibly damaging	0.82
IGL02926:Utrn	APN	10	12690760	missense	probably damaging	0.96
IGL03184:Utrn	APN	10	12710166	missense	probably benign	0.04
IGL03194:Utrn	APN	10	12406429	splice site	probably benign
IGL03346:Utrn	APN	10	12525352	missense	probably benign	0.22
retiring	UTSW	10	12641020	missense	probably damaging	1.00
shrinking_violet	UTSW	10	12711585	critical splice acceptor site	probably null
Wallflower	UTSW	10	12747975	missense	probably damaging	1.00
FR4548:Utrn	UTSW	10	12633941	critical splice donor site	probably benign
I2288:Utrn	UTSW	10	12421640	missense	probably damaging	1.00
PIT4677001:Utrn	UTSW	10	12666704	missense	probably benign	0.06
R0022:Utrn	UTSW	10	12709956	splice site	probably benign
R0024:Utrn	UTSW	10	12406011	missense	probably benign	0.00
R0024:Utrn	UTSW	10	12406011	missense	probably benign	0.00
R0026:Utrn	UTSW	10	12726196	splice site	probably benign
R0026:Utrn	UTSW	10	12726196	splice site	probably benign
R0091:Utrn	UTSW	10	12735204	missense	probably damaging	1.00
R0112:Utrn	UTSW	10	12686465	nonsense	probably null
R0126:Utrn	UTSW	10	12711475	missense	probably benign	0.02
R0184:Utrn	UTSW	10	12667618	missense	probably benign
R0219:Utrn	UTSW	10	12684451	missense	probably damaging	1.00
R0369:Utrn	UTSW	10	12634022	missense	probably benign	0.37
R0390:Utrn	UTSW	10	12710060	missense	probably benign	0.05
R0391:Utrn	UTSW	10	12525333	splice site	probably benign
R0408:Utrn	UTSW	10	12384190	makesense	probably null
R0409:Utrn	UTSW	10	12643601	missense	probably benign	0.01
R0441:Utrn	UTSW	10	12688294	missense	probably null	0.88
R0504:Utrn	UTSW	10	12402895	missense	probably benign	0.02
R0730:Utrn	UTSW	10	12698158	splice site	probably benign
R1078:Utrn	UTSW	10	12455566	critical splice acceptor site	probably null
R1171:Utrn	UTSW	10	12481308	missense	probably damaging	0.99
R1191:Utrn	UTSW	10	12634033	missense	probably benign	0.02
R1203:Utrn	UTSW	10	12486537	missense	probably damaging	1.00
R1401:Utrn	UTSW	10	12649153	missense	probably benign
R1418:Utrn	UTSW	10	12713350	missense	probably benign
R1439:Utrn	UTSW	10	12744049	missense	possibly damaging	0.79
R1441:Utrn	UTSW	10	12683295	missense	probably damaging	0.97
R1445:Utrn	UTSW	10	12678574	splice site	probably benign
R1509:Utrn	UTSW	10	12455441	missense	possibly damaging	0.91
R1546:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R1585:Utrn	UTSW	10	12436285	missense	possibly damaging	0.62
R1621:Utrn	UTSW	10	12713283	missense	probably benign	0.24
R1637:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R1703:Utrn	UTSW	10	12727729	splice site	probably benign
R1725:Utrn	UTSW	10	12663519	missense	probably damaging	0.99
R1735:Utrn	UTSW	10	12710138	missense	probably benign
R1770:Utrn	UTSW	10	12475296	missense	probably damaging	0.98
R1778:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R1783:Utrn	UTSW	10	12463339	missense	probably damaging	1.00
R1818:Utrn	UTSW	10	12709964	critical splice donor site	probably null
R1829:Utrn	UTSW	10	12475274	missense	probably damaging	1.00
R1919:Utrn	UTSW	10	12455480	missense	probably benign	0.15
R1964:Utrn	UTSW	10	12684437	missense	probably damaging	1.00
R2080:Utrn	UTSW	10	12737082	missense	probably benign	0.36
R2092:Utrn	UTSW	10	12678698	missense	probably benign	0.12
R2107:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R2108:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R2760:Utrn	UTSW	10	12690878	missense	probably damaging	1.00
R2884:Utrn	UTSW	10	12739361	splice site	probably null
R2885:Utrn	UTSW	10	12739361	splice site	probably null
R2886:Utrn	UTSW	10	12739361	splice site	probably null
R2903:Utrn	UTSW	10	12643428	missense	probably damaging	1.00
R2944:Utrn	UTSW	10	12643419	missense	probably damaging	1.00
R2945:Utrn	UTSW	10	12486391	missense	possibly damaging	0.50
R3438:Utrn	UTSW	10	12481318	missense	probably damaging	0.98
R3683:Utrn	UTSW	10	12666835	missense	probably benign	0.10
R3735:Utrn	UTSW	10	12478484	missense	probably damaging	1.00
R3907:Utrn	UTSW	10	12710182	splice site	probably benign
R3923:Utrn	UTSW	10	12739479	missense	probably benign	0.23
R3925:Utrn	UTSW	10	12698042	missense	probably benign
R3926:Utrn	UTSW	10	12698042	missense	probably benign
R3938:Utrn	UTSW	10	12750030	critical splice donor site	probably null
R3941:Utrn	UTSW	10	12711585	critical splice acceptor site	probably null
R3958:Utrn	UTSW	10	12750108	missense	probably damaging	1.00
R4091:Utrn	UTSW	10	12710171	missense	probably benign	0.10
R4454:Utrn	UTSW	10	12727840	missense	possibly damaging	0.81
R4585:Utrn	UTSW	10	12688306	missense	probably benign	0.01
R4667:Utrn	UTSW	10	12698053	missense	probably benign	0.22
R4684:Utrn	UTSW	10	12745240	missense	probably damaging	1.00
R4782:Utrn	UTSW	10	12750069	missense	probably damaging	1.00
R4785:Utrn	UTSW	10	12654745	missense	probably benign	0.39
R4799:Utrn	UTSW	10	12750069	missense	probably damaging	1.00
R4829:Utrn	UTSW	10	12663461	missense	probably benign	0.00
R4878:Utrn	UTSW	10	12727758	missense	probably damaging	1.00
R4955:Utrn	UTSW	10	12861567	critical splice donor site	probably null
R4967:Utrn	UTSW	10	12455420	missense	probably damaging	0.99
R5071:Utrn	UTSW	10	12384204	splice site	probably null
R5072:Utrn	UTSW	10	12384204	splice site	probably null
R5186:Utrn	UTSW	10	12728777	missense	probably damaging	1.00
R5213:Utrn	UTSW	10	12636760	missense	probably damaging	1.00
R5296:Utrn	UTSW	10	12401355	missense	probably damaging	1.00
R5309:Utrn	UTSW	10	12727769	missense	probably damaging	1.00
R5312:Utrn	UTSW	10	12727769	missense	probably damaging	1.00
R5399:Utrn	UTSW	10	12640983	missense	probably damaging	1.00
R5407:Utrn	UTSW	10	12680625	missense	probably damaging	1.00
R5411:Utrn	UTSW	10	12649185	missense	probably benign
R5428:Utrn	UTSW	10	12693431	missense	probably benign	0.09
R5595:Utrn	UTSW	10	12682318	missense	possibly damaging	0.89
R5602:Utrn	UTSW	10	12750095	missense	probably damaging	1.00
R5608:Utrn	UTSW	10	12671837	missense	probably benign	0.00
R5678:Utrn	UTSW	10	12442018	missense	probably damaging	1.00
R5726:Utrn	UTSW	10	12669806	missense	probably benign
R5804:Utrn	UTSW	10	12421625	missense	probably damaging	1.00
R5916:Utrn	UTSW	10	12665051	missense	probably damaging	0.97
R5941:Utrn	UTSW	10	12486483	missense	probably damaging	1.00
R6014:Utrn	UTSW	10	12690876	missense	probably benign	0.01
R6015:Utrn	UTSW	10	12478424	missense	possibly damaging	0.85
R6028:Utrn	UTSW	10	12654716	missense	probably benign	0.00
R6158:Utrn	UTSW	10	12690822	missense	probably benign	0.04
R6181:Utrn	UTSW	10	12739456	missense	probably damaging	1.00
R6300:Utrn	UTSW	10	12501476	missense	probably benign	0.35
R6367:Utrn	UTSW	10	12747975	missense	probably damaging	1.00
R6377:Utrn	UTSW	10	12744083	missense	probably damaging	1.00
R6434:Utrn	UTSW	10	12525427	missense	probably damaging	1.00
R6498:Utrn	UTSW	10	12442093	missense	probably benign
R6579:Utrn	UTSW	10	12748006	missense	probably benign	0.05
R6736:Utrn	UTSW	10	12621303	missense	probably benign	0.09
R6755:Utrn	UTSW	10	12699087	missense	probably benign	0.00
R6793:Utrn	UTSW	10	12640925	critical splice donor site	probably null
R6793:Utrn	UTSW	10	12699100	missense	possibly damaging	0.69
R6835:Utrn	UTSW	10	12727764	missense	probably damaging	1.00
R6919:Utrn	UTSW	10	12693470	nonsense	probably null
R6920:Utrn	UTSW	10	12750470	missense	probably damaging	0.98
R7037:Utrn	UTSW	10	12826770	splice site	probably null
R7038:Utrn	UTSW	10	12682338	missense	probably damaging	1.00
R7055:Utrn	UTSW	10	12747921	missense	probably benign	0.23
R7072:Utrn	UTSW	10	12465213	missense	probably damaging	1.00
R7090:Utrn	UTSW	10	12684516	missense	possibly damaging	0.58
R7211:Utrn	UTSW	10	12401335	missense	possibly damaging	0.72
R7248:Utrn	UTSW	10	12728818	missense	possibly damaging	0.51
R7305:Utrn	UTSW	10	12385536	missense	probably benign
R7334:Utrn	UTSW	10	12728009	splice site	probably null
R7348:Utrn	UTSW	10	12748018	missense	probably damaging	1.00
R7375:Utrn	UTSW	10	12641020	missense	probably damaging	1.00
R7436:Utrn	UTSW	10	12439791	missense	possibly damaging	0.72
R7476:Utrn	UTSW	10	12640951	missense	probably benign
R7514:Utrn	UTSW	10	12698089	missense	probably benign	0.00
R7527:Utrn	UTSW	10	12401382	missense	possibly damaging	0.81
R7735:Utrn	UTSW	10	12744043	critical splice donor site	probably null
R7748:Utrn	UTSW	10	12614508	missense	probably benign	0.01
R7778:Utrn	UTSW	10	12486610	missense	probably damaging	1.00
R7824:Utrn	UTSW	10	12486610	missense	probably damaging	1.00
R7826:Utrn	UTSW	10	12401306	splice site	probably null
R7872:Utrn	UTSW	10	12698129	missense	probably benign
R7915:Utrn	UTSW	10	12465212	missense	probably damaging	1.00
R7922:Utrn	UTSW	10	12667527	missense	possibly damaging	0.68
R8081:Utrn	UTSW	10	12548059	start gained	probably benign
R8132:Utrn	UTSW	10	12682410	missense	probably damaging	0.99
R8167:Utrn	UTSW	10	12671814	nonsense	probably null
R8186:Utrn	UTSW	10	12698123	missense	probably benign
R8331:Utrn	UTSW	10	12614619	missense	probably benign	0.00
R8352:Utrn	UTSW	10	12813509	missense	probably benign	0.34
R8408:Utrn	UTSW	10	12670143	missense	possibly damaging	0.69
R8452:Utrn	UTSW	10	12813509	missense	probably benign	0.34
R8478:Utrn	UTSW	10	12649148	missense	probably benign
R8489:Utrn	UTSW	10	12711446	missense	probably benign	0.05
R8516:Utrn	UTSW	10	12486510	missense	probably damaging	0.99
R8520:Utrn	UTSW	10	12670186	nonsense	probably null
R8550:Utrn	UTSW	10	12813585	intron	probably benign
R8856:Utrn	UTSW	10	12667607	missense	probably benign
R8881:Utrn	UTSW	10	12547993	missense	possibly damaging	0.46
R9180:Utrn	UTSW	10	12669719	missense	probably damaging	1.00
R9186:Utrn	UTSW	10	12614574	missense	probably benign
R9216:Utrn	UTSW	10	12813485	missense	probably benign	0.19
R9251:Utrn	UTSW	10	12636787	missense	probably benign	0.01
R9273:Utrn	UTSW	10	12633963	missense	probably damaging	0.97
R9307:Utrn	UTSW	10	12678731	missense	probably benign	0.02
R9344:Utrn	UTSW	10	12684531	missense	probably benign	0.17
R9419:Utrn	UTSW	10	12688381	missense	probably damaging	1.00
R9435:Utrn	UTSW	10	12643429	missense	probably damaging	1.00
R9623:Utrn	UTSW	10	12406481	missense	probably damaging	1.00
R9650:Utrn	UTSW	10	12738185	missense	probably benign	0.00
R9653:Utrn	UTSW	10	12621379	missense	probably benign	0.17
R9653:Utrn	UTSW	10	12663445	missense	probably benign	0.41
R9672:Utrn	UTSW	10	12727869	missense	possibly damaging	0.68
R9678:Utrn	UTSW	10	12739415	missense	probably benign	0.00
R9741:Utrn	UTSW	10	12826820	missense	probably benign
R9765:Utrn	UTSW	10	12735177	missense	probably damaging	0.99
R9799:Utrn	UTSW	10	12709992	missense	probably benign	0.01
RF009:Utrn	UTSW	10	12633945	nonsense	probably null
V1662:Utrn	UTSW	10	12421640	missense	probably damaging	1.00
X0018:Utrn	UTSW	10	12735198	missense	probably damaging	1.00
Z1176:Utrn	UTSW	10	12682360	nonsense	probably null
Z1176:Utrn	UTSW	10	12688429	critical splice acceptor site	probably null
Z1177:Utrn	UTSW	10	12525406	nonsense	probably null
Z1177:Utrn	UTSW	10	12621379	missense	probably benign	0.17
Z1186:Utrn	UTSW	10	12669747	missense	probably damaging	1.00
Z1189:Utrn	UTSW	10	12669747	missense	probably damaging	1.00
Z1191:Utrn	UTSW	10	12669747	missense	probably damaging	1.00
Z1192:Utrn	UTSW	10	12669747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAATATGGTAAAATGAGGATCCC -3'
(R):5'- CGTTGTCACACATGTCACTTTTAG -3'

Sequencing Primer
(F):5'- TGAGGATCCCTTAATTGTCATAGTG -3'
(R):5'- CGGTGCTATCTACATTGTT -3'

Posted On

2018-07-24