Incidental Mutation 'R6704:Pfkl'
ID528865
Institutional Source Beutler Lab
Gene Symbol Pfkl
Ensembl Gene ENSMUSG00000020277
Gene Namephosphofructokinase, liver, B-type
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location77986947-78010083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 77996366 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 297 (G297D)
Ref Sequence ENSEMBL: ENSMUSP00000020522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020522] [ENSMUST00000145716] [ENSMUST00000218383]
Predicted Effect probably damaging
Transcript: ENSMUST00000020522
AA Change: G297D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020522
Gene: ENSMUSG00000020277
AA Change: G297D

DomainStartEndE-ValueType
Pfam:PFK 17 324 4.7e-109 PFAM
Pfam:PFK 401 686 1.9e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149271
Predicted Effect probably benign
Transcript: ENSMUST00000218383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220064
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the liver (L) subunit of an enzyme that catalyzes the conversion of D-fructose 6-phosphate to D-fructose 1,6-bisphosphate, which is a key step in glucose metabolism (glycolysis). This enzyme is a tetramer that may be composed of different subunits encoded by distinct genes in different tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Pfkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Pfkl APN 10 77991395 missense probably benign
IGL01759:Pfkl APN 10 78000731 missense probably damaging 1.00
IGL02697:Pfkl APN 10 77999918 missense probably benign 0.09
IGL02870:Pfkl APN 10 78000839 nonsense probably null
IGL02942:Pfkl APN 10 78000133 critical splice donor site probably null
IGL02972:Pfkl APN 10 77988274 missense probably benign 0.00
IGL03342:Pfkl APN 10 78005475 missense possibly damaging 0.95
ANU23:Pfkl UTSW 10 77991395 missense probably benign
R0226:Pfkl UTSW 10 77992534 missense probably benign 0.00
R0743:Pfkl UTSW 10 77995243 critical splice donor site probably null
R0899:Pfkl UTSW 10 78005439 critical splice donor site probably null
R0926:Pfkl UTSW 10 78000689 missense probably damaging 1.00
R1264:Pfkl UTSW 10 77993416 missense possibly damaging 0.46
R1782:Pfkl UTSW 10 77988720 missense probably benign 0.00
R1918:Pfkl UTSW 10 78001426 missense probably damaging 1.00
R3743:Pfkl UTSW 10 77996345 missense probably damaging 1.00
R4559:Pfkl UTSW 10 77988883 missense probably benign 0.00
R4804:Pfkl UTSW 10 77991394 missense probably benign
R4823:Pfkl UTSW 10 77997594 missense probably damaging 1.00
R4906:Pfkl UTSW 10 77988310 missense probably damaging 1.00
R5082:Pfkl UTSW 10 77996408 missense probably damaging 1.00
R5216:Pfkl UTSW 10 78009670 missense probably damaging 0.99
R5380:Pfkl UTSW 10 77997589 missense possibly damaging 0.86
R5816:Pfkl UTSW 10 78002022 missense possibly damaging 0.75
R5840:Pfkl UTSW 10 77988724 missense probably benign
R5888:Pfkl UTSW 10 77991370 missense possibly damaging 0.68
R6143:Pfkl UTSW 10 77989613 missense probably damaging 0.96
R6152:Pfkl UTSW 10 77990151 missense probably benign 0.00
R6251:Pfkl UTSW 10 77989565 critical splice donor site probably null
R6262:Pfkl UTSW 10 77988673 critical splice donor site probably null
R6382:Pfkl UTSW 10 77999837 missense probably damaging 0.98
R6407:Pfkl UTSW 10 77988673 critical splice donor site probably null
R6547:Pfkl UTSW 10 77995354 missense probably benign
R6996:Pfkl UTSW 10 77997589 missense probably damaging 1.00
R7116:Pfkl UTSW 10 78001415 missense probably benign
R7154:Pfkl UTSW 10 78001455 missense probably benign 0.41
R7183:Pfkl UTSW 10 78002082 nonsense probably null
R7248:Pfkl UTSW 10 77989589 missense probably damaging 1.00
R7252:Pfkl UTSW 10 77993429 missense probably damaging 1.00
R7278:Pfkl UTSW 10 77992023 missense probably damaging 0.99
R7974:Pfkl UTSW 10 77994162 missense probably damaging 1.00
X0026:Pfkl UTSW 10 77989643 missense probably damaging 1.00
Z1176:Pfkl UTSW 10 78000136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATATACAGGGGTCAAGCCAGC -3'
(R):5'- TGACCCGCACATATCACGTG -3'

Sequencing Primer
(F):5'- AGCCCAGTTCCTCAGTACATG -3'
(R):5'- ATAGTGTGGCTTATTTCTCAGGC -3'
Posted On2018-07-24