Incidental Mutation 'R6704:Olfr824'
ID528866
Institutional Source Beutler Lab
Gene Symbol Olfr824
Ensembl Gene ENSMUSG00000095804
Gene Nameolfactory receptor 824
SynonymsGA_x6K02T2PULF-11797746-11796799, MOR210-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location130123470-130130000 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 130126155 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 301 (K301*)
Ref Sequence ENSEMBL: ENSMUSP00000150606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074161] [ENSMUST00000214192] [ENSMUST00000215217]
Predicted Effect probably null
Transcript: ENSMUST00000074161
AA Change: K301*
SMART Domains Protein: ENSMUSP00000073794
Gene: ENSMUSG00000095804
AA Change: K301*

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.6e-54 PFAM
Pfam:7tm_1 44 293 3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183140
Predicted Effect probably null
Transcript: ENSMUST00000214192
AA Change: K301*
Predicted Effect probably null
Transcript: ENSMUST00000215217
AA Change: K301*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Olfr824
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Olfr824 APN 10 130126991 missense probably benign 0.45
IGL02391:Olfr824 APN 10 130126904 missense possibly damaging 0.75
IGL03247:Olfr824 APN 10 130126715 missense probably damaging 1.00
R0781:Olfr824 UTSW 10 130126653 missense probably damaging 1.00
R1110:Olfr824 UTSW 10 130126653 missense probably damaging 1.00
R1694:Olfr824 UTSW 10 130126254 missense possibly damaging 0.93
R2069:Olfr824 UTSW 10 130126205 missense possibly damaging 0.94
R2173:Olfr824 UTSW 10 130126503 missense probably benign 0.10
R4078:Olfr824 UTSW 10 130126718 missense probably damaging 1.00
R4864:Olfr824 UTSW 10 130126887 nonsense probably null
R5556:Olfr824 UTSW 10 130126859 missense probably damaging 1.00
R7624:Olfr824 UTSW 10 130126586 missense probably damaging 0.98
R8013:Olfr824 UTSW 10 130126778 missense probably damaging 1.00
R8049:Olfr824 UTSW 10 130126600 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCCCAGCTACGACACTATG -3'
(R):5'- GGCTCTCATATAGCAGTGGTG -3'

Sequencing Primer
(F):5'- TCCCAGCTACGACACTATGCTTAC -3'
(R):5'- CTCATATAGCAGTGGTGAGTTTATTC -3'
Posted On2018-07-24