Incidental Mutation 'R6704:Sept4'
ID528868
Institutional Source Beutler Lab
Gene Symbol Sept4
Ensembl Gene ENSMUSG00000020486
Gene Nameseptin 4
Synonymscell division control-related protein 2b, ARTS, Pnutl2, septin H5, Bh5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87568903-87590539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87589030 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 277 (I277N)
Ref Sequence ENSEMBL: ENSMUSP00000115790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018544] [ENSMUST00000063156] [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000107960] [ENSMUST00000107961] [ENSMUST00000107962] [ENSMUST00000119628] [ENSMUST00000122067] [ENSMUST00000122945] [ENSMUST00000123105] [ENSMUST00000133202] [ENSMUST00000146871]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018544
AA Change: I287N

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018544
Gene: ENSMUSG00000020486
AA Change: I287N

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.8e-130 PFAM
Pfam:MMR_HSR1 146 290 1.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063156
AA Change: I188N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060127
Gene: ENSMUSG00000020486
AA Change: I188N

DomainStartEndE-ValueType
Pfam:DUF258 26 142 7.5e-7 PFAM
Pfam:Septin 42 322 7.5e-131 PFAM
Pfam:MMR_HSR1 47 211 5.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092802
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103179
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107960
AA Change: I287N

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103594
Gene: ENSMUSG00000020486
AA Change: I287N

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.1e-130 PFAM
Pfam:MMR_HSR1 146 293 7.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107961
AA Change: I181N

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103595
Gene: ENSMUSG00000020486
AA Change: I181N

DomainStartEndE-ValueType
Pfam:DUF258 19 135 1e-7 PFAM
Pfam:Septin 35 232 1.9e-89 PFAM
Pfam:MMR_HSR1 40 204 1.2e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107962
AA Change: I268N

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103596
Gene: ENSMUSG00000020486
AA Change: I268N

DomainStartEndE-ValueType
low complexity region 75 89 N/A INTRINSIC
Pfam:Septin 122 402 1.3e-130 PFAM
Pfam:MMR_HSR1 127 273 8.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119628
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122067
AA Change: I169N

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112960
Gene: ENSMUSG00000020486
AA Change: I169N

DomainStartEndE-ValueType
Pfam:DUF258 8 124 5.3e-7 PFAM
Pfam:Septin 23 303 3.9e-131 PFAM
Pfam:MMR_HSR1 28 172 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122945
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123081
Predicted Effect probably benign
Transcript: ENSMUST00000123105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132723
Predicted Effect probably damaging
Transcript: ENSMUST00000133202
AA Change: I277N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115790
Gene: ENSMUSG00000020486
AA Change: I277N

DomainStartEndE-ValueType
low complexity region 84 98 N/A INTRINSIC
Pfam:DUF258 114 232 1.4e-7 PFAM
Pfam:Septin 131 280 1.2e-72 PFAM
Pfam:MMR_HSR1 136 279 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148216
Predicted Effect probably benign
Transcript: ENSMUST00000146871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134923
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Sept4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Sept4 APN 11 87589773 missense probably damaging 1.00
IGL00963:Sept4 APN 11 87583373 missense possibly damaging 0.89
IGL03087:Sept4 APN 11 87585245 splice site probably benign
IGL03268:Sept4 APN 11 87589703 missense probably damaging 0.99
R0077:Sept4 UTSW 11 87581196 missense probably benign
R1729:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1730:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1739:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1762:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1783:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1784:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1785:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1957:Sept4 UTSW 11 87590367 missense probably benign 0.02
R2131:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2133:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2140:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2141:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2252:Sept4 UTSW 11 87589811 missense possibly damaging 0.75
R3696:Sept4 UTSW 11 87585234 missense possibly damaging 0.48
R4018:Sept4 UTSW 11 87585121 missense probably damaging 1.00
R4193:Sept4 UTSW 11 87583316 critical splice acceptor site probably null
R4196:Sept4 UTSW 11 87588772 missense probably damaging 0.96
R5012:Sept4 UTSW 11 87584404 missense possibly damaging 0.78
R5149:Sept4 UTSW 11 87589245 missense probably damaging 1.00
R5891:Sept4 UTSW 11 87588924 unclassified probably benign
R6090:Sept4 UTSW 11 87589517 missense possibly damaging 0.48
R6145:Sept4 UTSW 11 87585246 splice site probably null
R6257:Sept4 UTSW 11 87590349 missense probably benign 0.07
R7064:Sept4 UTSW 11 87590367 missense probably benign 0.02
R7090:Sept4 UTSW 11 87584438 missense probably damaging 1.00
R7784:Sept4 UTSW 11 87579008 missense probably benign
R7790:Sept4 UTSW 11 87589239 missense probably damaging 1.00
R8320:Sept4 UTSW 11 87589734 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGCAGTACTTCCGAGACGAG -3'
(R):5'- AAAGTGCTCGATCTCCTCCC -3'

Sequencing Primer
(F):5'- GTGGCCTGAACCGCAAGAAC -3'
(R):5'- TCCTCCCGGATCTGGCAAAC -3'
Posted On2018-07-24