Incidental Mutation 'R6704:Zc2hc1c'
ID528870
Institutional Source Beutler Lab
Gene Symbol Zc2hc1c
Ensembl Gene ENSMUSG00000045064
Gene Namezinc finger, C2HC-type containing 1C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location85288591-85299358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85290484 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 305 (Q305L)
Ref Sequence ENSEMBL: ENSMUSP00000051664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059341] [ENSMUST00000121930]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059341
AA Change: Q305L

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051664
Gene: ENSMUSG00000045064
AA Change: Q305L

DomainStartEndE-ValueType
low complexity region 93 106 N/A INTRINSIC
coiled coil region 207 254 N/A INTRINSIC
Pfam:zf-C2HC_2 378 402 3.6e-10 PFAM
low complexity region 433 444 N/A INTRINSIC
Pfam:zf-C2HC_2 489 513 3.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121930
SMART Domains Protein: ENSMUSP00000112609
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 64 156 4.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Other mutations in Zc2hc1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Zc2hc1c APN 12 85289676 missense probably benign 0.03
IGL02677:Zc2hc1c APN 12 85290076 missense probably benign 0.31
R1053:Zc2hc1c UTSW 12 85296556 missense probably damaging 1.00
R1696:Zc2hc1c UTSW 12 85290781 missense possibly damaging 0.86
R1724:Zc2hc1c UTSW 12 85289812 missense probably benign 0.00
R1905:Zc2hc1c UTSW 12 85290514 missense probably benign 0.03
R1996:Zc2hc1c UTSW 12 85296660 missense probably benign 0.31
R4463:Zc2hc1c UTSW 12 85290297 missense probably damaging 0.97
R4834:Zc2hc1c UTSW 12 85290208 missense probably damaging 1.00
R5070:Zc2hc1c UTSW 12 85290514 missense probably benign 0.03
R5943:Zc2hc1c UTSW 12 85289709 missense probably damaging 1.00
R6184:Zc2hc1c UTSW 12 85296444 missense probably damaging 0.96
R6701:Zc2hc1c UTSW 12 85289672 splice site probably null
R6719:Zc2hc1c UTSW 12 85290672 missense probably damaging 1.00
R7665:Zc2hc1c UTSW 12 85296562 missense possibly damaging 0.69
R8125:Zc2hc1c UTSW 12 85296612 missense probably damaging 1.00
R8154:Zc2hc1c UTSW 12 85290172 missense probably benign 0.00
R8268:Zc2hc1c UTSW 12 85289821 missense probably benign 0.02
R8356:Zc2hc1c UTSW 12 85290697 missense probably damaging 0.97
R8678:Zc2hc1c UTSW 12 85290310 missense probably benign 0.07
R8875:Zc2hc1c UTSW 12 85289775 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATCCGCAGAAAGGAGATTCTC -3'
(R):5'- ACTTGACTCCTGCAGTGTAC -3'

Sequencing Primer
(F):5'- GAGATTCTCCTACAAGAAAAGCTG -3'
(R):5'- AGTGTACTGCCCAGCTCC -3'
Posted On2018-07-24