Incidental Mutation 'R6704:Omd'
ID528871
Institutional Source Beutler Lab
Gene Symbol Omd
Ensembl Gene ENSMUSG00000048368
Gene Nameosteomodulin
Synonymsosteoadherin, OSAD, SLRR2C
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location49582462-49592822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49589873 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 133 (D133G)
Ref Sequence ENSEMBL: ENSMUSP00000152066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000065494] [ENSMUST00000221170]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065494
AA Change: D133G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065706
Gene: ENSMUSG00000048368
AA Change: D133G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 61 95 3.14e-11 SMART
LRR 115 139 2.15e2 SMART
LRR 140 160 2.2e1 SMART
LRR 162 184 4.21e1 SMART
LRR 185 210 1.01e2 SMART
LRR 211 234 6.96e0 SMART
LRR 235 255 8.49e1 SMART
LRR 256 279 1.76e-1 SMART
LRR 300 322 7.8e1 SMART
Blast:LRR 330 353 6e-8 BLAST
low complexity region 385 391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221170
AA Change: D133G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221751
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired cued contextual conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Omd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Omd APN 13 49589643 nonsense probably null
IGL01982:Omd APN 13 49589497 missense possibly damaging 0.88
IGL02678:Omd APN 13 49592281 missense probably benign 0.37
IGL03069:Omd APN 13 49592394 utr 3 prime probably benign
R1036:Omd UTSW 13 49589971 missense probably damaging 1.00
R3954:Omd UTSW 13 49589737 missense probably benign 0.00
R4030:Omd UTSW 13 49589649 missense probably benign 0.08
R4335:Omd UTSW 13 49590236 missense probably benign 0.02
R5095:Omd UTSW 13 49589698 missense possibly damaging 0.95
R5137:Omd UTSW 13 49590076 missense probably benign 0.05
R5400:Omd UTSW 13 49592227 missense probably benign 0.37
R5596:Omd UTSW 13 49592338 missense probably benign 0.16
R5930:Omd UTSW 13 49589636 missense possibly damaging 0.63
R6132:Omd UTSW 13 49590367 missense probably damaging 0.97
R6294:Omd UTSW 13 49589991 missense probably damaging 1.00
R6454:Omd UTSW 13 49589869 missense probably damaging 0.99
R6680:Omd UTSW 13 49589528 missense possibly damaging 0.74
R6932:Omd UTSW 13 49590234 missense probably damaging 1.00
R7427:Omd UTSW 13 49592269 missense possibly damaging 0.68
R7884:Omd UTSW 13 49590154 missense probably damaging 1.00
R7971:Omd UTSW 13 49590254 missense probably benign 0.00
R8129:Omd UTSW 13 49592089 missense probably damaging 0.99
R8399:Omd UTSW 13 49589869 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCTAAGGAATGCTTCTGTCCAAC -3'
(R):5'- TATAGCAGAGGTCAAGCATAGTCAC -3'

Sequencing Primer
(F):5'- CTTTCCAACATCAATGTACTGTGAC -3'
(R):5'- GAGGTCAAGCATAGTCACATTCAC -3'
Posted On2018-07-24