Incidental Mutation 'R6704:Ccdc152'
ID528874
Institutional Source Beutler Lab
Gene Symbol Ccdc152
Ensembl Gene ENSMUSG00000091119
Gene Namecoiled-coil domain containing 152
SynonymsENSMUSG00000071814
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location3280070-3303526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3280713 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 227 (I227F)
Ref Sequence ENSEMBL: ENSMUSP00000153730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082424] [ENSMUST00000159158] [ENSMUST00000159216] [ENSMUST00000160787] [ENSMUST00000160930] [ENSMUST00000165386] [ENSMUST00000226261] [ENSMUST00000228405]
Predicted Effect probably benign
Transcript: ENSMUST00000082424
SMART Domains Protein: ENSMUSP00000081004
Gene: ENSMUSG00000064373

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:SelP_N 22 248 5.4e-119 PFAM
Pfam:SelP_C 249 380 2.6e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159158
SMART Domains Protein: ENSMUSP00000125632
Gene: ENSMUSG00000064373

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:SelP_N 22 124 5.4e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159216
SMART Domains Protein: ENSMUSP00000124305
Gene: ENSMUSG00000064373

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:SelP_N 23 268 9.3e-108 PFAM
Pfam:SelP_C 249 380 4.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160787
SMART Domains Protein: ENSMUSP00000124852
Gene: ENSMUSG00000064373

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:SelP_N 22 139 1.6e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160930
SMART Domains Protein: ENSMUSP00000125505
Gene: ENSMUSG00000064373

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:SelP_N 22 177 1.9e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165386
AA Change: I227F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129305
Gene: ENSMUSG00000091119
AA Change: I227F

DomainStartEndE-ValueType
coiled coil region 76 186 N/A INTRINSIC
coiled coil region 211 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226261
AA Change: I227F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228405
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Ccdc152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Ccdc152 APN 15 3293847 splice site probably benign
IGL01543:Ccdc152 APN 15 3298124 missense possibly damaging 0.91
R0622:Ccdc152 UTSW 15 3298178 missense probably damaging 0.96
R1605:Ccdc152 UTSW 15 3298121 missense probably damaging 0.99
R2875:Ccdc152 UTSW 15 3298181 missense probably damaging 1.00
R2876:Ccdc152 UTSW 15 3298181 missense probably damaging 1.00
R4990:Ccdc152 UTSW 15 3301157 missense probably benign 0.00
R5114:Ccdc152 UTSW 15 3282837 missense probably damaging 0.99
R5732:Ccdc152 UTSW 15 3292378 critical splice donor site probably null
R6336:Ccdc152 UTSW 15 3301129 missense probably damaging 1.00
R7593:Ccdc152 UTSW 15 3280655 missense probably damaging 1.00
R8300:Ccdc152 UTSW 15 3298152 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGTGGCTACAGTACACACTTATC -3'
(R):5'- AAATGAGAGGGCAGGCCTTTC -3'

Sequencing Primer
(F):5'- ATTGTTCAGCATGCTCACATTG -3'
(R):5'- CAGGCCTTTCAGAGTAAGCTAGTC -3'
Posted On2018-07-24