Incidental Mutation 'R6704:Olfr187'
ID528876
Institutional Source Beutler Lab
Gene Symbol Olfr187
Ensembl Gene ENSMUSG00000043357
Gene Nameolfactory receptor 187
SynonymsGA_x54KRFPKG5P-55265713-55264787, MOR183-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59035563-59039767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59035862 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 292 (R292G)
Ref Sequence ENSEMBL: ENSMUSP00000147035 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000206428
AA Change: R292G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207673
AA Change: R292G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Olfr187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Olfr187 APN 16 59035906 missense probably damaging 1.00
R0218:Olfr187 UTSW 16 59036093 missense probably benign 0.00
R1023:Olfr187 UTSW 16 59035815 missense probably benign 0.00
R1086:Olfr187 UTSW 16 59036263 missense probably damaging 1.00
R1472:Olfr187 UTSW 16 59036557 missense probably damaging 1.00
R4710:Olfr187 UTSW 16 59036275 missense possibly damaging 0.94
R4738:Olfr187 UTSW 16 59036195 missense probably benign 0.00
R5265:Olfr187 UTSW 16 59036143 missense possibly damaging 0.94
R6053:Olfr187 UTSW 16 59035988 missense probably damaging 1.00
R6854:Olfr187 UTSW 16 59036065 missense possibly damaging 0.75
R7178:Olfr187 UTSW 16 59035933 missense probably benign 0.06
R7198:Olfr187 UTSW 16 59036093 missense probably benign 0.00
R7404:Olfr187 UTSW 16 59036240 missense possibly damaging 0.81
R7462:Olfr187 UTSW 16 59036016 nonsense probably null
R7938:Olfr187 UTSW 16 59035962 nonsense probably null
R8785:Olfr187 UTSW 16 59036167 missense probably damaging 1.00
R8790:Olfr187 UTSW 16 59036217 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATTTGTTAGGAAGCACTCATGTG -3'
(R):5'- AAGAAAGCCTTCTCCACCTGTG -3'

Sequencing Primer
(F):5'- ATGTTTTAAGGAGATTTGAGGCAC -3'
(R):5'- GTGGGGCCCATCTCCTATC -3'
Posted On2018-07-24