Incidental Mutation 'R6704:Fndc1'
ID528877
Institutional Source Beutler Lab
Gene Symbol Fndc1
Ensembl Gene ENSMUSG00000071984
Gene Namefibronectin type III domain containing 1
Synonyms1110027O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location7738569-7827302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7771810 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1018 (V1018A)
Ref Sequence ENSEMBL: ENSMUSP00000095036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097425]
Predicted Effect unknown
Transcript: ENSMUST00000097425
AA Change: V1018A
SMART Domains Protein: ENSMUSP00000095036
Gene: ENSMUSG00000071984
AA Change: V1018A

DomainStartEndE-ValueType
Blast:FN3 1 50 6e-25 BLAST
FN3 54 137 7.82e-4 SMART
FN3 156 240 1.48e-4 SMART
FN3 256 340 3.67e-9 SMART
low complexity region 377 388 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 646 676 N/A INTRINSIC
low complexity region 766 777 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 1021 1027 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
Blast:FN3 1227 1276 2e-18 BLAST
low complexity region 1277 1354 N/A INTRINSIC
low complexity region 1395 1403 N/A INTRINSIC
low complexity region 1407 1423 N/A INTRINSIC
FN3 1494 1577 4.32e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114579
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mcam T A 9: 44,136,920 D124E probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Fndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Fndc1 APN 17 7765254 missense unknown
IGL00590:Fndc1 APN 17 7765101 missense unknown
IGL00765:Fndc1 APN 17 7772693 missense unknown
IGL00904:Fndc1 APN 17 7756363 missense probably benign 0.35
IGL01153:Fndc1 APN 17 7780042 critical splice donor site probably null
IGL01557:Fndc1 APN 17 7756389 missense probably damaging 0.99
IGL02493:Fndc1 APN 17 7775545 missense unknown
IGL02501:Fndc1 APN 17 7765398 missense unknown
IGL02503:Fndc1 APN 17 7771516 missense unknown
IGL02887:Fndc1 APN 17 7773638 missense unknown
IGL03348:Fndc1 APN 17 7772647 missense unknown
pinnacle UTSW 17 7773322 missense unknown
spire UTSW 17 7771480 missense unknown
IGL02988:Fndc1 UTSW 17 7753523 missense possibly damaging 0.95
PIT4466001:Fndc1 UTSW 17 7750374 missense probably damaging 1.00
R0336:Fndc1 UTSW 17 7765107 missense unknown
R0403:Fndc1 UTSW 17 7753723 missense probably damaging 1.00
R0403:Fndc1 UTSW 17 7775588 splice site probably null
R0538:Fndc1 UTSW 17 7784341 splice site probably benign
R0646:Fndc1 UTSW 17 7741673 missense possibly damaging 0.92
R1140:Fndc1 UTSW 17 7775426 missense unknown
R1523:Fndc1 UTSW 17 7773209 missense unknown
R1609:Fndc1 UTSW 17 7772766 missense unknown
R1632:Fndc1 UTSW 17 7773200 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R2004:Fndc1 UTSW 17 7804929 missense probably damaging 1.00
R2007:Fndc1 UTSW 17 7778748 unclassified probably benign
R2128:Fndc1 UTSW 17 7778665 unclassified probably benign
R2187:Fndc1 UTSW 17 7741772 missense probably damaging 1.00
R2251:Fndc1 UTSW 17 7753607 missense probably damaging 1.00
R2322:Fndc1 UTSW 17 7789015 missense probably damaging 0.98
R2425:Fndc1 UTSW 17 7805018 missense probably damaging 1.00
R2921:Fndc1 UTSW 17 7804875 missense probably damaging 0.98
R2985:Fndc1 UTSW 17 7756323 missense possibly damaging 0.93
R3436:Fndc1 UTSW 17 7750357 missense probably damaging 0.99
R3499:Fndc1 UTSW 17 7753584 missense possibly damaging 0.70
R3508:Fndc1 UTSW 17 7765108 nonsense probably null
R3766:Fndc1 UTSW 17 7784421 missense probably damaging 1.00
R3813:Fndc1 UTSW 17 7773322 missense unknown
R3814:Fndc1 UTSW 17 7773322 missense unknown
R4031:Fndc1 UTSW 17 7769752 nonsense probably null
R4544:Fndc1 UTSW 17 7773544 missense unknown
R4583:Fndc1 UTSW 17 7739249 missense probably damaging 1.00
R4619:Fndc1 UTSW 17 7765204 missense unknown
R4700:Fndc1 UTSW 17 7771480 missense unknown
R4743:Fndc1 UTSW 17 7772279 nonsense probably null
R4803:Fndc1 UTSW 17 7753706 missense probably damaging 0.98
R4862:Fndc1 UTSW 17 7769735 missense unknown
R4876:Fndc1 UTSW 17 7771639 missense unknown
R5057:Fndc1 UTSW 17 7771970 nonsense probably null
R5327:Fndc1 UTSW 17 7772708 missense unknown
R5372:Fndc1 UTSW 17 7765210 missense unknown
R5533:Fndc1 UTSW 17 7772776 missense unknown
R5754:Fndc1 UTSW 17 7769753 missense unknown
R5762:Fndc1 UTSW 17 7771534 missense unknown
R5830:Fndc1 UTSW 17 7789086 missense possibly damaging 0.87
R5924:Fndc1 UTSW 17 7773610 missense unknown
R6147:Fndc1 UTSW 17 7753762 splice site probably null
R6175:Fndc1 UTSW 17 7772647 missense unknown
R6303:Fndc1 UTSW 17 7758485 missense probably damaging 0.98
R6377:Fndc1 UTSW 17 7769735 missense unknown
R6857:Fndc1 UTSW 17 7772170 missense unknown
R6865:Fndc1 UTSW 17 7772840 missense unknown
R7069:Fndc1 UTSW 17 7769735 missense unknown
R7153:Fndc1 UTSW 17 7801645 missense probably damaging 1.00
R7159:Fndc1 UTSW 17 7800931 missense probably damaging 0.97
R7359:Fndc1 UTSW 17 7813486 splice site probably null
R7731:Fndc1 UTSW 17 7773439 missense unknown
R7743:Fndc1 UTSW 17 7765137 missense unknown
R7884:Fndc1 UTSW 17 7773197 missense unknown
R8071:Fndc1 UTSW 17 7772530 missense unknown
R8100:Fndc1 UTSW 17 7771853 missense unknown
R8317:Fndc1 UTSW 17 7800888 nonsense probably null
R8362:Fndc1 UTSW 17 7782375 missense unknown
R8835:Fndc1 UTSW 17 7739279 missense probably damaging 1.00
R8841:Fndc1 UTSW 17 7773349 missense unknown
Z1088:Fndc1 UTSW 17 7782479 missense probably damaging 0.96
Z1176:Fndc1 UTSW 17 7773593 nonsense probably null
Z1176:Fndc1 UTSW 17 7804877 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTTCGAGGCTGGTACCAGGTAG -3'
(R):5'- AAACCTCAGCAGATGGGCTC -3'

Sequencing Primer
(F):5'- TGGTGATCGCCTTCCGG -3'
(R):5'- CCAGTCAGGGAACAGTGGC -3'
Posted On2018-07-24