Incidental Mutation 'R6705:Fam168b'
ID528882
Institutional Source Beutler Lab
Gene Symbol Fam168b
Ensembl Gene ENSMUSG00000037503
Gene Namefamily with sequence similarity 168, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6705 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34813219-34843065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34828783 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 45 (N45K)
Ref Sequence ENSEMBL: ENSMUSP00000139456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047534] [ENSMUST00000167518] [ENSMUST00000170092] [ENSMUST00000185231] [ENSMUST00000185469] [ENSMUST00000191307]
Predicted Effect probably benign
Transcript: ENSMUST00000047534
AA Change: N45K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503
AA Change: N45K

DomainStartEndE-ValueType
Pfam:TCRP1 1 194 1e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140534
Predicted Effect possibly damaging
Transcript: ENSMUST00000167518
AA Change: N45K

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503
AA Change: N45K

DomainStartEndE-ValueType
Pfam:TCRP1 1 62 3.3e-26 PFAM
Pfam:TCRP1 54 206 1.1e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170092
AA Change: N45K

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128676
Gene: ENSMUSG00000037503
AA Change: N45K

DomainStartEndE-ValueType
Pfam:TCRP1 1 201 8.8e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185231
AA Change: N45K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139456
Gene: ENSMUSG00000037503
AA Change: N45K

DomainStartEndE-ValueType
Pfam:TCRP1 1 90 7.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185279
Predicted Effect possibly damaging
Transcript: ENSMUST00000185469
AA Change: N45K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141150
Gene: ENSMUSG00000037503
AA Change: N45K

DomainStartEndE-ValueType
Pfam:TCRP1 1 66 3.6e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191307
AA Change: N45K

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140573
Gene: ENSMUSG00000037503
AA Change: N45K

DomainStartEndE-ValueType
Pfam:TCRP1 1 206 2.8e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192924
Meta Mutation Damage Score 0.0756 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Fam168b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Fam168b APN 1 34836802 start codon destroyed probably null 0.58
R0207:Fam168b UTSW 1 34819688 missense probably damaging 0.98
R2008:Fam168b UTSW 1 34819865 critical splice donor site probably null
R4020:Fam168b UTSW 1 34828779 missense possibly damaging 0.71
R4617:Fam168b UTSW 1 34819982 missense possibly damaging 0.90
R5154:Fam168b UTSW 1 34818099 missense possibly damaging 0.83
R6167:Fam168b UTSW 1 34819603 missense probably damaging 1.00
R6600:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6602:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6603:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6627:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6628:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6644:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6692:Fam168b UTSW 1 34836741 missense probably damaging 1.00
R6985:Fam168b UTSW 1 34819708 missense probably damaging 1.00
R7387:Fam168b UTSW 1 34819708 missense probably damaging 1.00
Z1177:Fam168b UTSW 1 34819882 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTACCTGTACAGCCCAGAGG -3'
(R):5'- GAGAAGCTGACTAGAGATGATTTTG -3'

Sequencing Primer
(F):5'- TGGCGGGCAGATCTGAG -3'
(R):5'- ACTAGAGATGATTTTGTTTTGAGCAG -3'
Posted On2018-07-24