Incidental Mutation 'R6705:D1Pas1'
ID528883
Institutional Source Beutler Lab
Gene Symbol D1Pas1
Ensembl Gene ENSMUSG00000039224
Gene NameDNA segment, Chr 1, Pasteur Institute 1
SynonymsPl10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6705 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location186967416-186970627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 186968379 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 168 (E168D)
Ref Sequence ENSEMBL: ENSMUSP00000035261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045108]
Predicted Effect probably benign
Transcript: ENSMUST00000045108
AA Change: E168D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000035261
Gene: ENSMUSG00000039224
AA Change: E168D

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 80 102 N/A INTRINSIC
low complexity region 104 122 N/A INTRINSIC
DEXDc 198 417 9.08e-66 SMART
HELICc 454 535 1.23e-35 SMART
low complexity region 580 596 N/A INTRINSIC
low complexity region 598 654 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191895
Meta Mutation Damage Score 0.0906 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in D1Pas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:D1Pas1 APN 1 186969412 missense possibly damaging 0.55
IGL00921:D1Pas1 APN 1 186968786 missense probably benign 0.44
R1693:D1Pas1 UTSW 1 186968029 missense probably benign
R2029:D1Pas1 UTSW 1 186968089 missense possibly damaging 0.53
R3732:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3732:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3733:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3930:D1Pas1 UTSW 1 186968280 missense probably damaging 1.00
R5302:D1Pas1 UTSW 1 186969445 missense probably damaging 1.00
R5815:D1Pas1 UTSW 1 186968009 missense probably damaging 1.00
R7023:D1Pas1 UTSW 1 186968008 missense probably damaging 0.96
R7747:D1Pas1 UTSW 1 186968677 missense probably benign 0.08
R7862:D1Pas1 UTSW 1 186968152 missense probably damaging 1.00
R7945:D1Pas1 UTSW 1 186968152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGGCTTTGGCAAATTTGAG -3'
(R):5'- CTGGACCATCCGTATAGATCTGAC -3'

Sequencing Primer
(F):5'- TGGCAAATTTGAGCGGGGC -3'
(R):5'- GAAAAGCTGCTGTTTTTCCAGACC -3'
Posted On2018-07-24