Incidental Mutation 'R6705:Xrn2'
ID528886
Institutional Source Beutler Lab
Gene Symbol Xrn2
Ensembl Gene ENSMUSG00000027433
Gene Name5'-3' exoribonuclease 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6705 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location147012996-147078000 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 147036662 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028921]
Predicted Effect probably null
Transcript: ENSMUST00000028921
SMART Domains Protein: ENSMUSP00000028921
Gene: ENSMUSG00000027433

DomainStartEndE-ValueType
Pfam:XRN_N 1 254 1.5e-104 PFAM
ZnF_C2HC 262 278 7.99e-1 SMART
low complexity region 415 427 N/A INTRINSIC
PDB:3FQD|A 469 785 8e-75 PDB
low complexity region 913 932 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147057
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5'-3' exonuclease that promotes transcription termination at cotranscriptional cleavage sites. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Xrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Xrn2 APN 2 147036750 missense probably benign 0.00
IGL00950:Xrn2 APN 2 147028146 nonsense probably null
IGL01323:Xrn2 APN 2 147034847 splice site probably benign
IGL01328:Xrn2 APN 2 147029930 missense possibly damaging 0.90
IGL01545:Xrn2 APN 2 147038179 missense probably benign
IGL01729:Xrn2 APN 2 147036797 critical splice donor site probably null
IGL01805:Xrn2 APN 2 147028143 missense probably damaging 0.98
IGL02326:Xrn2 APN 2 147047713 missense probably benign 0.32
IGL02332:Xrn2 APN 2 147026590 missense probably damaging 1.00
IGL02556:Xrn2 APN 2 147038296 splice site probably benign
IGL02609:Xrn2 APN 2 147050025 missense probably benign 0.00
IGL02941:Xrn2 APN 2 147026524 missense probably damaging 1.00
IGL03119:Xrn2 APN 2 147042872 missense probably damaging 1.00
R0052:Xrn2 UTSW 2 147040965 splice site probably benign
R0114:Xrn2 UTSW 2 147029779 missense probably damaging 0.98
R0196:Xrn2 UTSW 2 147047660 missense probably damaging 0.99
R0799:Xrn2 UTSW 2 147029898 missense probably benign 0.03
R0991:Xrn2 UTSW 2 147042082 missense probably benign 0.40
R1444:Xrn2 UTSW 2 147061488 missense probably damaging 0.99
R1727:Xrn2 UTSW 2 147061516 missense probably benign 0.00
R1735:Xrn2 UTSW 2 147061423 missense probably damaging 1.00
R1885:Xrn2 UTSW 2 147049361 nonsense probably null
R2199:Xrn2 UTSW 2 147024750 missense probably damaging 0.96
R2884:Xrn2 UTSW 2 147047656 missense probably damaging 1.00
R3730:Xrn2 UTSW 2 147024809 missense probably benign 0.09
R3771:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3772:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3773:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3816:Xrn2 UTSW 2 147028200 missense probably damaging 1.00
R3927:Xrn2 UTSW 2 147038189 missense probably benign
R4173:Xrn2 UTSW 2 147047692 missense probably damaging 0.96
R4659:Xrn2 UTSW 2 147061474 missense probably benign 0.01
R4928:Xrn2 UTSW 2 147051718 missense possibly damaging 0.80
R5452:Xrn2 UTSW 2 147024713 critical splice acceptor site probably null
R5527:Xrn2 UTSW 2 147029755 missense probably benign 0.02
R6297:Xrn2 UTSW 2 147026570 missense probably damaging 1.00
R6301:Xrn2 UTSW 2 147063342 missense probably benign 0.05
R6316:Xrn2 UTSW 2 147042010 missense probably damaging 1.00
R7173:Xrn2 UTSW 2 147042093 missense probably damaging 1.00
R7408:Xrn2 UTSW 2 147042097 critical splice donor site probably null
R7412:Xrn2 UTSW 2 147049346 missense probably damaging 0.99
R7501:Xrn2 UTSW 2 147029756 missense probably damaging 1.00
R7856:Xrn2 UTSW 2 147068473 intron probably null
Z1177:Xrn2 UTSW 2 147028206 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATTGCATTTGGCTTCAAGAGGAC -3'
(R):5'- TGTTCATCACCCAACGTCAC -3'

Sequencing Primer
(F):5'- ACAGGCTTGTCTACAGCTG -3'
(R):5'- CGTCACACAGAAGTAGTAAGCC -3'
Posted On2018-07-24