Incidental Mutation 'R6705:Zbp1'
ID528887
Institutional Source Beutler Lab
Gene Symbol Zbp1
Ensembl Gene ENSMUSG00000027514
Gene NameZ-DNA binding protein 1
SynonymsDai, mZaDLM
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6705 (G1)
Quality Score202.009
Status Validated
Chromosome2
Chromosomal Location173206612-173218923 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 173213887 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 161 (C161*)
Ref Sequence ENSEMBL: ENSMUSP00000104744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029018] [ENSMUST00000109116]
Predicted Effect probably benign
Transcript: ENSMUST00000029018
SMART Domains Protein: ENSMUSP00000029018
Gene: ENSMUSG00000027514

DomainStartEndE-ValueType
Zalpha 6 72 5.32e-23 SMART
Zalpha 82 147 7.64e-24 SMART
Pfam:RHIM 163 202 1.8e-8 PFAM
Pfam:RHIM 208 258 1.2e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109116
AA Change: C161*
SMART Domains Protein: ENSMUSP00000104744
Gene: ENSMUSG00000027514
AA Change: C161*

DomainStartEndE-ValueType
Zalpha 6 72 5.32e-23 SMART
Zalpha 82 147 7.64e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146802
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display normal innate immune activation by double-stranded B-form DNA (B-DNA) as well as normal adaptive immune responses to DNA vaccination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Zbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Zbp1 APN 2 173212245 missense possibly damaging 0.95
IGL01924:Zbp1 APN 2 173212254 missense probably benign 0.09
IGL02804:Zbp1 APN 2 173209146 missense probably damaging 1.00
PIT4362001:Zbp1 UTSW 2 173216990 missense probably damaging 1.00
R2100:Zbp1 UTSW 2 173209244 missense probably damaging 1.00
R2269:Zbp1 UTSW 2 173218823 start gained probably benign
R3795:Zbp1 UTSW 2 173212179 missense probably benign 0.21
R4649:Zbp1 UTSW 2 173207815 missense possibly damaging 0.56
R4653:Zbp1 UTSW 2 173207815 missense possibly damaging 0.56
R4792:Zbp1 UTSW 2 173209213 missense probably damaging 1.00
R4807:Zbp1 UTSW 2 173212206 missense probably damaging 1.00
R5899:Zbp1 UTSW 2 173210547 missense probably benign 0.29
R6290:Zbp1 UTSW 2 173215841 missense probably damaging 1.00
R6835:Zbp1 UTSW 2 173213911 critical splice acceptor site probably null
R7269:Zbp1 UTSW 2 173213872 missense unknown
R7337:Zbp1 UTSW 2 173218753 nonsense probably null
R7419:Zbp1 UTSW 2 173209165 missense probably benign 0.00
R7429:Zbp1 UTSW 2 173213818 missense unknown
R7508:Zbp1 UTSW 2 173207811 missense possibly damaging 0.72
R8021:Zbp1 UTSW 2 173209210 missense possibly damaging 0.78
Z1177:Zbp1 UTSW 2 173207741 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCATACTTGGGATGAAACAGTTTAG -3'
(R):5'- TAGTCACTTGAAGAAGGCAGGC -3'

Sequencing Primer
(F):5'- CTTGGGATGAAACAGTTTAGAGATGC -3'
(R):5'- CTGGGCTAGACTTGTATAGAAGCC -3'
Posted On2018-07-24