Incidental Mutation 'R6705:Skint10'
ID528889
Institutional Source Beutler Lab
Gene Symbol Skint10
Ensembl Gene ENSMUSG00000048766
Gene Nameselection and upkeep of intraepithelial T cells 10
SynonymsA030001H23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6705 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location112711147-112774866 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 112773104 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060327] [ENSMUST00000068851]
Predicted Effect probably benign
Transcript: ENSMUST00000060327
SMART Domains Protein: ENSMUSP00000058838
Gene: ENSMUSG00000048766

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:4F8T|A 50 149 5e-8 PDB
Blast:IG_like 56 143 3e-11 BLAST
transmembrane domain 162 184 N/A INTRINSIC
transmembrane domain 212 229 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000068851
AA Change: I43N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137128
Meta Mutation Damage Score 0.5022 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Skint10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02660:Skint10 APN 4 112765030 unclassified probably benign
IGL02891:Skint10 APN 4 112728826 missense probably benign 0.03
R0067:Skint10 UTSW 4 112711556 missense probably benign
R0067:Skint10 UTSW 4 112711556 missense probably benign
R0540:Skint10 UTSW 4 112773027 critical splice donor site probably null
R0544:Skint10 UTSW 4 112728811 splice site probably benign
R0711:Skint10 UTSW 4 112715905 splice site probably benign
R1135:Skint10 UTSW 4 112711463 nonsense probably null
R1341:Skint10 UTSW 4 112765031 unclassified probably benign
R2845:Skint10 UTSW 4 112715826 missense probably benign 0.00
R3717:Skint10 UTSW 4 112746739 missense probably damaging 1.00
R3718:Skint10 UTSW 4 112746739 missense probably damaging 1.00
R4349:Skint10 UTSW 4 112769771 makesense probably null
R4857:Skint10 UTSW 4 112746633 missense possibly damaging 0.92
R4988:Skint10 UTSW 4 112728872 nonsense probably null
R5010:Skint10 UTSW 4 112727672 missense probably benign 0.14
R5354:Skint10 UTSW 4 112711593 missense possibly damaging 0.57
R5567:Skint10 UTSW 4 112715870 missense probably damaging 0.98
R5716:Skint10 UTSW 4 112711647 missense probably damaging 0.97
R5827:Skint10 UTSW 4 112746775 missense probably benign 0.00
R7220:Skint10 UTSW 4 112728973 missense probably benign 0.00
R7620:Skint10 UTSW 4 112715817 missense possibly damaging 0.78
R7724:Skint10 UTSW 4 112765092 nonsense probably null
R7827:Skint10 UTSW 4 112774806 nonsense probably null
R8007:Skint10 UTSW 4 112711668 missense possibly damaging 0.87
R8056:Skint10 UTSW 4 112715813 missense probably benign 0.02
X0028:Skint10 UTSW 4 112746665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGCTGAGCACTGACTTGAAG -3'
(R):5'- AACCTTGAGTGCCATCACCC -3'

Sequencing Primer
(F):5'- CTGAGCACTGACTTGAAGAAAGGAC -3'
(R):5'- CACAGTAAAAATGGTGTCTGCTG -3'
Posted On2018-07-24