Incidental Mutation 'R6705:Erlin2'
ID 528899
Institutional Source Beutler Lab
Gene Symbol Erlin2
Ensembl Gene ENSMUSG00000031483
Gene Name ER lipid raft associated 2
Synonyms Spfh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6705 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 27023261-27040328 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 27036440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 276 (L276Q)
Ref Sequence ENSEMBL: ENSMUSP00000033873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033873] [ENSMUST00000209520] [ENSMUST00000209563] [ENSMUST00000209795] [ENSMUST00000211043] [ENSMUST00000211233]
AlphaFold Q8BFZ9
Predicted Effect probably damaging
Transcript: ENSMUST00000033873
AA Change: L276Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033873
Gene: ENSMUSG00000031483
AA Change: L276Q

DomainStartEndE-ValueType
PHB 21 187 1.62e-36 SMART
low complexity region 235 246 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209504
AA Change: L193Q
Predicted Effect probably benign
Transcript: ENSMUST00000209520
Predicted Effect probably benign
Transcript: ENSMUST00000209563
Predicted Effect probably benign
Transcript: ENSMUST00000209795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210445
Predicted Effect probably benign
Transcript: ENSMUST00000211043
Predicted Effect probably benign
Transcript: ENSMUST00000211233
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Erlin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Erlin2 APN 8 27036548 missense probably benign
IGL01534:Erlin2 APN 8 27031957 nonsense probably null
IGL02719:Erlin2 APN 8 27029675 unclassified probably benign
R0193:Erlin2 UTSW 8 27031764 missense possibly damaging 0.82
R4479:Erlin2 UTSW 8 27025099 missense probably benign 0.02
R4878:Erlin2 UTSW 8 27027166 splice site probably null
R4965:Erlin2 UTSW 8 27029595 missense probably damaging 0.99
R5082:Erlin2 UTSW 8 27033407 missense probably damaging 0.98
R5939:Erlin2 UTSW 8 27036526 missense probably benign 0.24
R6172:Erlin2 UTSW 8 27036095 critical splice donor site probably null
R7033:Erlin2 UTSW 8 27031764 missense probably benign 0.03
R7537:Erlin2 UTSW 8 27031772 critical splice donor site probably null
R8161:Erlin2 UTSW 8 27028942 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGGAAGCCTTAATAGAAGC -3'
(R):5'- GCTCATCTTCTAGGCCAAAGC -3'

Sequencing Primer
(F):5'- GGAAAACTCTGGAAACTGTTGCTAC -3'
(R):5'- AGCCCAGCTTGTCGTCG -3'
Posted On 2018-07-24