Incidental Mutation 'R6705:Myf6'
ID528905
Institutional Source Beutler Lab
Gene Symbol Myf6
Ensembl Gene ENSMUSG00000035923
Gene Namemyogenic factor 6
SynonymsbHLHc4, MRF4, herculin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R6705 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location107492853-107494737 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107493829 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 198 (V198M)
Ref Sequence ENSEMBL: ENSMUSP00000047529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044210
AA Change: V198M

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047529
Gene: ENSMUSG00000035923
AA Change: V198M

DomainStartEndE-ValueType
BASIC 3 98 4.23e-40 SMART
HLH 99 150 8.72e-15 SMART
low complexity region 210 221 N/A INTRINSIC
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a probable basic helix-loop-helix (bHLH) DNA binding protein involved in muscle differentiation. The encoded protein likely acts as a heterodimer with another bHLH protein. Defects in this gene are a cause of autosomal dominant centronuclear myopathy (ADCNM). [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted mutations exhibit variable rib abnormalities, abnormal intercostal muscle morphology, reduced expression of Myf5, and postnatal mortality proportional to the severity of the rib defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Myf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Myf6 APN 10 107494398 missense probably damaging 1.00
IGL03131:Myf6 APN 10 107494271 missense probably damaging 1.00
R0067:Myf6 UTSW 10 107493479 splice site probably null
R0067:Myf6 UTSW 10 107493479 splice site probably null
R0562:Myf6 UTSW 10 107494559 missense probably benign 0.45
R1635:Myf6 UTSW 10 107494673 missense probably damaging 1.00
R1700:Myf6 UTSW 10 107493359 missense probably damaging 1.00
R4361:Myf6 UTSW 10 107494432 small deletion probably benign
R4686:Myf6 UTSW 10 107493828 missense probably benign
R5601:Myf6 UTSW 10 107494614 missense probably damaging 0.99
R6229:Myf6 UTSW 10 107494419 missense possibly damaging 0.92
R7024:Myf6 UTSW 10 107494529 missense probably damaging 1.00
Z1176:Myf6 UTSW 10 107494260 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGCTCTTTGTGCTCAGCCAG -3'
(R):5'- AATGCAGTCTGGCCCAAGAAAG -3'

Sequencing Primer
(F):5'- TCAGCCAGAGCACTCCTGTG -3'
(R):5'- TCTGGCCCAAGAAAGCAGGG -3'
Posted On2018-07-24