Incidental Mutation 'R6705:Olfr786'
ID528908
Institutional Source Beutler Lab
Gene Symbol Olfr786
Ensembl Gene ENSMUSG00000095696
Gene Nameolfactory receptor 786
SynonymsGA_x6K02T2PULF-11116958-11117896, MOR111-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6705 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129427306-129439080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129437072 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 87 (D87N)
Ref Sequence ENSEMBL: ENSMUSP00000145099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076508] [ENSMUST00000204529]
Predicted Effect probably benign
Transcript: ENSMUST00000076508
AA Change: D87N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075827
Gene: ENSMUSG00000095696
AA Change: D87N

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 7.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204529
AA Change: D87N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145099
Gene: ENSMUSG00000095696
AA Change: D87N

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 7.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Olfr786
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Olfr786 APN 10 129437034 missense possibly damaging 0.95
IGL03027:Olfr786 APN 10 129436911 missense probably damaging 1.00
IGL03177:Olfr786 APN 10 129436815 start codon destroyed probably null 0.82
IGL03216:Olfr786 APN 10 129436937 missense probably damaging 0.98
IGL03265:Olfr786 APN 10 129436925 missense possibly damaging 0.83
R0080:Olfr786 UTSW 10 129437271 missense possibly damaging 0.85
R0082:Olfr786 UTSW 10 129437271 missense possibly damaging 0.85
R0242:Olfr786 UTSW 10 129437348 missense probably damaging 1.00
R0242:Olfr786 UTSW 10 129437348 missense probably damaging 1.00
R0507:Olfr786 UTSW 10 129437288 missense probably benign 0.00
R1432:Olfr786 UTSW 10 129436938 missense probably damaging 1.00
R1563:Olfr786 UTSW 10 129437711 missense probably benign
R2023:Olfr786 UTSW 10 129437582 missense probably damaging 0.99
R2142:Olfr786 UTSW 10 129437747 missense probably benign 0.14
R2279:Olfr786 UTSW 10 129437657 missense probably benign 0.07
R3412:Olfr786 UTSW 10 129437307 missense probably damaging 0.99
R4467:Olfr786 UTSW 10 129437064 missense probably benign 0.04
R4529:Olfr786 UTSW 10 129437418 missense probably benign 0.03
R4843:Olfr786 UTSW 10 129437447 missense probably benign 0.01
R4888:Olfr786 UTSW 10 129437379 missense possibly damaging 0.95
R4890:Olfr786 UTSW 10 129437079 missense probably benign 0.08
R6255:Olfr786 UTSW 10 129437688 missense possibly damaging 0.95
R6362:Olfr786 UTSW 10 129436943 missense probably damaging 1.00
R7270:Olfr786 UTSW 10 129437450 missense probably benign
R7450:Olfr786 UTSW 10 129437429 missense probably benign 0.00
R7803:Olfr786 UTSW 10 129436931 missense probably damaging 1.00
X0052:Olfr786 UTSW 10 129437499 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGGATTGTCAGATGACCC -3'
(R):5'- AGGCAAAGACCAACATTTTGC -3'

Sequencing Primer
(F):5'- CCAAAGCTCCAGGTTGTGATC -3'
(R):5'- GACCAACATTTTGCAGACCTTC -3'
Posted On2018-07-24