Incidental Mutation 'R6705:Etaa1'
ID528909
Institutional Source Beutler Lab
Gene Symbol Etaa1
Ensembl Gene ENSMUSG00000016984
Gene NameEwing tumor-associated antigen 1
Synonyms5730466H23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6705 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location17938756-17953875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17945639 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 826 (N826S)
Ref Sequence ENSEMBL: ENSMUSP00000075957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076661]
Predicted Effect probably benign
Transcript: ENSMUST00000076661
AA Change: N826S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000075957
Gene: ENSMUSG00000016984
AA Change: N826S

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ETAA1 79 865 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Etaa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Etaa1 APN 11 17947825 nonsense probably null
IGL00555:Etaa1 APN 11 17947535 missense probably damaging 1.00
IGL01098:Etaa1 APN 11 17946059 missense probably damaging 0.99
IGL01100:Etaa1 APN 11 17952576 critical splice donor site probably null
IGL01312:Etaa1 APN 11 17945909 missense probably damaging 1.00
IGL01391:Etaa1 APN 11 17946005 missense probably damaging 1.00
IGL01607:Etaa1 APN 11 17953637 missense probably benign 0.00
IGL02066:Etaa1 APN 11 17946687 missense probably benign
R0401:Etaa1 UTSW 11 17947514 missense probably damaging 1.00
R0413:Etaa1 UTSW 11 17946350 nonsense probably null
R0790:Etaa1 UTSW 11 17946051 missense probably benign 0.00
R1442:Etaa1 UTSW 11 17947201 missense probably benign 0.19
R1447:Etaa1 UTSW 11 17946625 missense possibly damaging 0.92
R1647:Etaa1 UTSW 11 17946492 missense probably damaging 0.99
R1945:Etaa1 UTSW 11 17947233 missense probably damaging 0.96
R1996:Etaa1 UTSW 11 17952671 missense probably damaging 1.00
R2211:Etaa1 UTSW 11 17952686 nonsense probably null
R2338:Etaa1 UTSW 11 17945605 critical splice donor site probably null
R3027:Etaa1 UTSW 11 17947886 missense probably damaging 1.00
R3546:Etaa1 UTSW 11 17953823 start gained probably benign
R4118:Etaa1 UTSW 11 17946180 missense probably benign 0.18
R4156:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
R4657:Etaa1 UTSW 11 17946964 missense possibly damaging 0.81
R4882:Etaa1 UTSW 11 17946174 missense probably benign 0.10
R4914:Etaa1 UTSW 11 17946532 missense probably benign 0.05
R4978:Etaa1 UTSW 11 17946581 missense probably damaging 0.99
R5202:Etaa1 UTSW 11 17947853 missense probably damaging 1.00
R5384:Etaa1 UTSW 11 17947539 missense probably damaging 1.00
R5584:Etaa1 UTSW 11 17947406 missense possibly damaging 0.72
R6303:Etaa1 UTSW 11 17947505 missense probably damaging 1.00
R6304:Etaa1 UTSW 11 17947505 missense probably damaging 1.00
R6351:Etaa1 UTSW 11 17947188 missense possibly damaging 0.95
R6391:Etaa1 UTSW 11 17946833 missense probably benign 0.04
R6685:Etaa1 UTSW 11 17953582 missense probably benign 0.40
R6807:Etaa1 UTSW 11 17952680 missense probably benign
R6863:Etaa1 UTSW 11 17953794 start codon destroyed probably benign 0.01
R6985:Etaa1 UTSW 11 17946108 missense probably damaging 0.99
R7129:Etaa1 UTSW 11 17940339 missense possibly damaging 0.92
R7429:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
Z1088:Etaa1 UTSW 11 17946465 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CTCAAGATGCACCTTTTGAGG -3'
(R):5'- ACAGCTTAGCAGATACAGCTCAG -3'

Sequencing Primer
(F):5'- TGCACCTTTTGAGGTATGATTAATG -3'
(R):5'- GCTTAGCAGATACAGCTCAGAATGAC -3'
Posted On2018-07-24