Incidental Mutation 'R6705:Aldh5a1'
ID528914
Institutional Source Beutler Lab
Gene Symbol Aldh5a1
Ensembl Gene ENSMUSG00000035936
Gene Namealdhehyde dehydrogenase family 5, subfamily A1
SynonymsD630032B01Rik, SSADH, 6330403E24Rik, OTTMUSG00000000613
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R6705 (G1)
Quality Score189.009
Status Validated
Chromosome13
Chromosomal Location24907579-24937661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24912270 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 448 (N448K)
Ref Sequence ENSEMBL: ENSMUSP00000040591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037615]
Predicted Effect probably damaging
Transcript: ENSMUST00000037615
AA Change: N448K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040591
Gene: ENSMUSG00000035936
AA Change: N448K

DomainStartEndE-ValueType
Pfam:Aldedh 57 518 7.7e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225028
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. This gene encodes a mitochondrial NAD(+)-dependent succinic semialdehyde dehydrogenase. A deficiency of this enzyme, known as 4-hydroxybutyricaciduria, is a rare inborn error in the metabolism of the neurotransmitter 4-aminobutyric acid (GABA). In response to the defect, physiologic fluids from patients accumulate GHB, a compound with numerous neuromodulatory properties. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body weight, ataxia, seizures, gliosis of the hippocampus, and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Aldh5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Aldh5a1 APN 13 24926158 splice site probably benign
IGL01468:Aldh5a1 APN 13 24911553 utr 3 prime probably benign
IGL01538:Aldh5a1 APN 13 24918512 missense possibly damaging 0.90
IGL02839:Aldh5a1 APN 13 24911620 missense probably damaging 1.00
R0529:Aldh5a1 UTSW 13 24913873 missense probably benign 0.00
R1820:Aldh5a1 UTSW 13 24927572 missense probably benign 0.01
R2295:Aldh5a1 UTSW 13 24926099 missense probably damaging 1.00
R4231:Aldh5a1 UTSW 13 24911653 missense probably damaging 1.00
R4591:Aldh5a1 UTSW 13 24924008 missense probably damaging 1.00
R4865:Aldh5a1 UTSW 13 24911584 missense probably damaging 1.00
R5159:Aldh5a1 UTSW 13 24913793 missense possibly damaging 0.72
R5563:Aldh5a1 UTSW 13 24918626 missense possibly damaging 0.95
R6146:Aldh5a1 UTSW 13 24919678 critical splice donor site probably null
R6362:Aldh5a1 UTSW 13 24918550 missense probably benign 0.24
R6531:Aldh5a1 UTSW 13 24918564 missense probably benign 0.11
R7151:Aldh5a1 UTSW 13 24937399 nonsense probably null
R7155:Aldh5a1 UTSW 13 24911589 missense possibly damaging 0.74
R7698:Aldh5a1 UTSW 13 24911748 missense probably damaging 0.99
R8027:Aldh5a1 UTSW 13 24926110 nonsense probably null
Z1177:Aldh5a1 UTSW 13 24911638 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCACATTGCTCAGTCC -3'
(R):5'- CTTGGAGAAGGCTGAGTTACC -3'

Sequencing Primer
(F):5'- TCAGTCCTGCCTCAGAGTGTG -3'
(R):5'- AGGCTGAGTTACCATGTCTGCAC -3'
Posted On2018-07-24